BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF12e06.yg.2.1
(561 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF133885.1|CF133885 WHE4364_G12_M24ZT Wheat meiotic flor... 147 9e-034
gb|CK208073.1|CK208073 FGAS019754 Triticum aestivum FGAS: L... 52 4e-005
>gb|CF133885.1|CF133885 WHE4364_G12_M24ZT Wheat meiotic floret cDNA library Triticum
aestivum cDNA clone WHE4364_G12_M24, mRNA sequence
Length = 732
Score = 147 bits (74), Expect = 9e-034
Identities = 125/142 (88%)
Strand = Plus / Minus
Query: 403 catgggttgagtcaggccttggacatgattatggaatcagccatgtcgatatagagaagg 462
|||||||| |||| || |||||| | ||||||||||| |||| |||||||||||| ||||
Sbjct: 732 catgggttcagtccggtcttggatacgattatggaattagccgtgtcgatatagaaaagg 673
Query: 463 ctgctactctgcactacaatggtgtgatgaaaccttggcttgacttggggatacttgatt 522
| ||| ||||||||||||||||||| ||||||||||||||||| |||| |||| |||||
Sbjct: 672 cggctgctctgcactacaatggtgtcatgaaaccttggcttgatttggcaatacatgatt 613
Query: 523 acaagaactactggaggaagta 544
|||||| ||||||||| |||||
Sbjct: 612 acaagagctactggagaaagta 591
>gb|CK208073.1|CK208073 FGAS019754 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1052
Score = 52.0 bits (26), Expect = 4e-005
Identities = 56/66 (84%)
Strand = Plus / Plus
Query: 472 tgcactacaatggtgtgatgaaaccttggcttgacttggggatacttgattacaagaact 531
|||||||||||||| ||||||||||||||||| ||||| |||| |||||| ||| |
Sbjct: 626 tgcactacaatggtaatatgaaaccttggcttgaattgggtataccaaattacaggaagt 685
Query: 532 actgga 537
||||||
Sbjct: 686 actgga 691
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 87,893
Number of Sequences: 636343
Number of extensions: 87893
Number of successful extensions: 22039
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22036
Number of HSP's gapped (non-prelim): 3
length of query: 561
length of database: 367,240,239
effective HSP length: 19
effective length of query: 542
effective length of database: 355,149,722
effective search space: 192491149324
effective search space used: 192491149324
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)