BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.064D08F020918.3.1
(559 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF235641.1|CF235641 PtaJXT0025C2C0206 Poplar cDNA librar... 36 1.4
gb|DT481229.1|DT481229 WS02531.BR_E10 PT-MB-N-A-15 Populus ... 36 1.4
gb|DT486541.1|DT486541 WS02531.B21_E10 PT-MB-N-A-15 Populus... 36 1.4
gb|AI162807.1|AI162807 A024P43U Hybrid aspen plasmid librar... 34 5.4
gb|AI163006.1|AI163006 A028P62U Hybrid aspen plasmid librar... 34 5.4
gb|AI163173.1|AI163173 A034p4u Hybrid aspen plasmid library... 34 5.4
gb|AI163390.1|AI163390 A041P05U Hybrid aspen plasmid librar... 34 5.4
gb|AI163569.1|AI163569 A044P53U Hybrid aspen plasmid librar... 34 5.4
gb|AI163998.1|AI163998 A052p30u Hybrid aspen plasmid librar... 34 5.4
gb|AI164056.1|AI164056 A053P80U Hybrid aspen plasmid librar... 34 5.4
gb|AI164845.1|AI164845 A069p61u Hybrid aspen plasmid librar... 34 5.4
gb|AI164879.1|AI164879 A070P22U Hybrid aspen plasmid librar... 34 5.4
gb|AI165466.1|AI165466 A084P46U Hybrid aspen plasmid librar... 34 5.4
gb|AI165762.1|AI165762 A090P55U Hybrid aspen plasmid librar... 34 5.4
gb|AI165844.1|AI165844 A092P66U Hybrid aspen plasmid librar... 34 5.4
gb|BI068607.1|BI068607 C024P48U Populus strain T89 leaves P... 34 5.4
gb|BI069559.1|BI069559 C003P18U Populus strain T89 leaves P... 34 5.4
gb|BI071690.1|BI071690 C062P34U Populus strain T89 leaves P... 34 5.4
gb|BI072137.1|BI072137 C070P10U Populus strain T89 leaves P... 34 5.4
gb|BI072776.1|BI072776 C087P10U Populus strain T89 leaves P... 34 5.4
gb|BI119644.1|BI119644 F002P95Y Populus flower cDNA library... 34 5.4
gb|BI119707.1|BI119707 F003P86Y Populus flower cDNA library... 34 5.4
gb|BI120327.1|BI120327 F013P52Y Populus flower cDNA library... 34 5.4
gb|BI121914.1|BI121914 F049P74Y Populus flower cDNA library... 34 5.4
gb|BI122000.1|BI122000 F051P21Y Populus flower cDNA library... 34 5.4
gb|BI123282.1|BI123282 I020P72P Populus leaf cDNA library P... 34 5.4
gb|BI123293.1|BI123293 I021P01P Populus leaf cDNA library P... 34 5.4
gb|BI124562.1|BI124562 I046P73P Populus leaf cDNA library P... 34 5.4
gb|BI124702.1|BI124702 I049P63P Populus leaf cDNA library P... 34 5.4
gb|BI125140.1|BI125140 I056P35P Populus leaf cDNA library P... 34 5.4
gb|BI125256.1|BI125256 I058P05P Populus leaf cDNA library P... 34 5.4
gb|BI129592.1|BI129592 G092P94Y Populus cambium cDNA librar... 34 5.4
gb|BI130339.1|BI130339 G104P12Y Populus cambium cDNA librar... 34 5.4
gb|BI139345.1|BI139345 F129P76Y Populus flower cDNA library... 34 5.4
gb|BU809140.1|BU809140 UL54PC01 Populus leaf cDNA library P... 34 5.4
gb|BU809516.1|BU809516 UL58TG04 Populus leaf cDNA library P... 34 5.4
gb|BU810271.1|BU810271 UL68E02 Populus leaf cDNA library Po... 34 5.4
gb|BU810521.1|BU810521 UL71PF01 Populus leaf cDNA library P... 34 5.4
gb|BU811351.1|BU811351 UL83TB12 Populus leaf cDNA library P... 34 5.4
gb|BU811575.1|BU811575 UL86TA10 Populus leaf cDNA library P... 34 5.4
gb|BU811882.1|BU811882 UL89TF07 Populus leaf cDNA library P... 34 5.4
gb|BU812264.1|BU812264 UL94TB10 Populus leaf cDNA library P... 34 5.4
gb|BU813152.1|BU813152 N005H07 Populus bark cDNA library Po... 34 5.4
gb|BU821948.1|BU821948 UB31BPA02 Populus tremula cambium cD... 34 5.4
gb|BU822182.1|BU822182 UB33BPE08 Populus tremula cambium cD... 34 5.4
gb|BU822199.1|BU822199 UB33BPG02 Populus tremula cambium cD... 34 5.4
gb|BU822816.1|BU822816 UB43DPG12 Populus tremula cambium cD... 34 5.4
gb|BU823918.1|BU823918 UB58DPB03 Populus tremula cambium cD... 34 5.4
gb|BU824667.1|BU824667 UB67DPD09 Populus tremula cambium cD... 34 5.4
gb|BU825429.1|BU825429 UK108TF05 Populus apical shoot cDNA ... 34 5.4
gb|BU826188.1|BU826188 UK117TF05 Populus apical shoot cDNA ... 34 5.4
gb|BU827475.1|BU827475 K003P29P Populus apical shoot cDNA l... 34 5.4
gb|BU828169.1|BU828169 K018P02P Populus apical shoot cDNA l... 34 5.4
gb|BU828670.1|BU828670 K026P62P Populus apical shoot cDNA l... 34 5.4
gb|BU828918.1|BU828918 K031P20P Populus apical shoot cDNA l... 34 5.4
gb|BU829298.1|BU829298 K038P02P Populus apical shoot cDNA l... 34 5.4
gb|BU831333.1|BU831333 T020C09 Populus apical shoot cDNA li... 34 5.4
gb|BU832816.1|BU832816 T038E09 Populus apical shoot cDNA li... 34 5.4
gb|BU833065.1|BU833065 T041D08 Populus apical shoot cDNA li... 34 5.4
gb|BU833595.1|BU833595 T050B06 Populus apical shoot cDNA li... 34 5.4
gb|BU834499.1|BU834499 T061H09 Populus apical shoot cDNA li... 34 5.4
gb|BU834712.1|BU834712 T064G10 Populus apical shoot cDNA li... 34 5.4
gb|BU835177.1|BU835177 T070E11 Populus apical shoot cDNA li... 34 5.4
gb|BU835860.1|BU835860 T079E11 Populus apical shoot cDNA li... 34 5.4
gb|BU836927.1|BU836927 T092F03 Populus apical shoot cDNA li... 34 5.4
gb|BU836937.1|BU836937 T092G02 Populus apical shoot cDNA li... 34 5.4
gb|BU861444.1|BU861444 S002B06 Populus imbibed seed cDNA li... 34 5.4
gb|BU865100.1|BU865100 S049B01 Populus imbibed seed cDNA li... 34 5.4
gb|BU867403.1|BU867403 S077G10 Populus imbibed seed cDNA li... 34 5.4
gb|BU868099.1|BU868099 M111C01 Populus flower cDNA library ... 34 5.4
gb|BU868399.1|BU868399 M115C08 Populus flower cDNA library ... 34 5.4
gb|BU870122.1|BU870122 Q008I23 Populus flower cDNA library ... 34 5.4
gb|BU870603.1|BU870603 Q015H02 Populus flower cDNA library ... 34 5.4
gb|BU871575.1|BU871575 Q032A12 Populus flower cDNA library ... 34 5.4
gb|BU873523.1|BU873523 Q056E02 Populus flower cDNA library ... 34 5.4
gb|BU874255.1|BU874255 Q066A10 Populus flower cDNA library ... 34 5.4
gb|BU876411.1|BU876411 V020D01 Populus flower cDNA library ... 34 5.4
gb|BU879347.1|BU879347 V059A12 Populus flower cDNA library ... 34 5.4
gb|BU880176.1|BU880176 UM42TD09 Populus flower cDNA library... 34 5.4
gb|BU880254.1|BU880254 UM43TE02 Populus flower cDNA library... 34 5.4
gb|BU880847.1|BU880847 UM55TF08 Populus flower cDNA library... 34 5.4
gb|BU881315.1|BU881315 UM61TB11 Populus flower cDNA library... 34 5.4
gb|BU881434.1|BU881434 UM62TF06 Populus flower cDNA library... 34 5.4
gb|BU881516.1|BU881516 UM63TG06 Populus flower cDNA library... 34 5.4
gb|BU882153.1|BU882153 UM73TC10 Populus flower cDNA library... 34 5.4
gb|BU882158.1|BU882158 UM73TD05 Populus flower cDNA library... 34 5.4
gb|BU882447.1|BU882447 UM77TB02 Populus flower cDNA library... 34 5.4
gb|BU882468.1|BU882468 UM77TD01 Populus flower cDNA library... 34 5.4
gb|BU882720.1|BU882720 UM81TC11 Populus flower cDNA library... 34 5.4
gb|BU882991.1|BU882991 UM84TH09 Populus flower cDNA library... 34 5.4
gb|BU882993.1|BU882993 UM84TH11 Populus flower cDNA library... 34 5.4
gb|BU884762.1|BU884762 R015B09 Populus root cDNA library Po... 34 5.4
gb|BU885467.1|BU885467 R031G01 Populus root cDNA library Po... 34 5.4
gb|BU886373.1|BU886373 R044E10 Populus root cDNA library Po... 34 5.4
gb|BU886886.1|BU886886 R051G10 Populus root cDNA library Po... 34 5.4
gb|BU889043.1|BU889043 P016A03 Populus petioles cDNA librar... 34 5.4
gb|BU889706.1|BU889706 P024F02 Populus petioles cDNA librar... 34 5.4
gb|BU890697.1|BU890697 P040E07 Populus petioles cDNA librar... 34 5.4
gb|BU891338.1|BU891338 P048H05 Populus petioles cDNA librar... 34 5.4
gb|BU891842.1|BU891842 P055H01 Populus petioles cDNA librar... 34 5.4
gb|BU892038.1|BU892038 P058E10 Populus petioles cDNA librar... 34 5.4
gb|BU893158.1|BU893158 P074A08 Populus petioles cDNA librar... 34 5.4
gb|BU893299.1|BU893299 P075H08 Populus petioles cDNA librar... 34 5.4
gb|BU893664.1|BU893664 P080G02 Populus petioles cDNA librar... 34 5.4
gb|BU893802.1|BU893802 P082G12 Populus petioles cDNA librar... 34 5.4
gb|BU896114.1|BU896114 X035G03 Populus wood cDNA library Po... 34 5.4
gb|CA925117.1|CA925117 MTU7TL.P13.G04 Aspen leaf cDNA Libra... 34 5.4
gb|CA927622.1|CA927622 MTU6TR.P11.B03 Aspen root cDNA Libra... 34 5.4
gb|CA930377.1|CA930377 MTU4CA.P21.H02 Aspen apex cDNA Libra... 34 5.4
gb|CA822880.1|CA822880 R15B11 two-month-old roots from clon... 34 5.4
gb|CA823960.1|CA823960 R34B02 two-month-old roots from clon... 34 5.4
gb|CA825476.1|CA825476 R59F07 two-month-old roots from clon... 34 5.4
gb|CB239419.1|CB239419 RSH11A06 two-month-old roots from cl... 34 5.4
gb|CB239672.1|CB239672 RSH15B08 two-month-old roots from cl... 34 5.4
gb|CB833338.1|CB833338 R01G09 two-month-old roots from clon... 34 5.4
gb|CF230552.1|CF230552 PtaC0009G4G0414 Poplar cDNA library ... 34 5.4
gb|CF231133.1|CF231133 PtaC0017G2G0214 Poplar cDNA library ... 34 5.4
gb|CF231670.1|CF231670 PtaC0024C4C0406 Poplar cDNA library ... 34 5.4
gb|CF231829.1|CF231829 PtaC0026C7C0705 Poplar cDNA library ... 34 5.4
gb|CF232518.1|CF232518 PtaJXO0011D9D0907 Poplar cDNA librar... 34 5.4
gb|CF232668.1|CF232668 PtaJXO0014C4C0406 Poplar cDNA librar... 34 5.4
gb|CF233945.1|CF233945 PtaJXO0029E3E0309 Poplar cDNA librar... 34 5.4
gb|CF234014.1|CF234014 PtaJXO1D6D0608 Poplar cDNA library f... 34 5.4
gb|CF234969.1|CF234969 PtaJXT0017C7C0705 Poplar cDNA librar... 34 5.4
gb|CF235367.1|CF235367 PtaJXT0022A2A0202 Poplar cDNA librar... 34 5.4
gb|CF236446.1|CF236446 PtaJXT2H1H0115 Poplar cDNA library f... 34 5.4
gb|CF236619.1|CF236619 PtaJXT5A3A0301 Poplar cDNA library f... 34 5.4
gb|CF236910.1|CF236910 PtaJXT8F6F0612 Poplar cDNA library f... 34 5.4
gb|CF236944.1|CF236944 PtaJXT9A6A0602 Poplar cDNA library f... 34 5.4
gb|CF237185.1|CF237185 Ptajxtjxt3A9A0901 Poplar cDNA librar... 34 5.4
gb|CK089459.1|CK089459 C011P45.3pR Populus strain T89 leave... 34 5.4
gb|CK094958.1|CK094958 I063P07.3pR Populus senescing leaves... 34 5.4
gb|CK095513.1|CK095513 UA12BPA05.3pR Populus dormant cambiu... 34 5.4
gb|CK098811.1|CK098811 A034P04.5pR Hybrid aspen plasmid lib... 34 5.4
gb|CK098945.1|CK098945 A044P53.5pR Hybrid aspen plasmid lib... 34 5.4
gb|CK099788.1|CK099788 A084P46.5pR Hybrid aspen plasmid lib... 34 5.4
gb|CK109299.1|CK109299 K068P33 Populus apical shoot cDNA li... 34 5.4
gb|CK109584.1|CK109584 N019C05 Populus bark cDNA library Po... 34 5.4
gb|CK110345.1|CK110345 N055H08 Populus bark cDNA library Po... 34 5.4
gb|CK110502.1|CK110502 N067D03 Populus bark cDNA library Po... 34 5.4
gb|CK111067.1|CK111067 Q008E12 Populus dormant bud cDNA lib... 34 5.4
gb|CK115750.1|CK115750 Y014H02 Populus infected leaf substr... 34 5.4
gb|CK116274.1|CK116274 A034P04 Hybrid aspen plasmid library... 34 5.4
gb|CK116386.1|CK116386 B011P11 Hybrid aspen plasmid library... 34 5.4
gb|CK116702.1|CK116702 B016P10 Hybrid aspen plasmid library... 34 5.4
gb|CN193422.1|CN193422 PtdH942 hybrid poplar systemically w... 34 5.4
gb|CN517993.1|CN517993 GQ0091.B3_B01 GQ009 Populus trichoca... 34 5.4
gb|CN518091.1|CN518091 GQ0092.B3_N14 GQ009 Populus trichoca... 34 5.4
gb|CN518665.1|CN518665 GQ0102.B3_L08 GQ010 Populus trichoca... 34 5.4
gb|CN519337.1|CN519337 GQ0102.B3_M05 GQ010 Populus trichoca... 34 5.4
gb|CN519570.1|CN519570 GQ0102.B3_F11 GQ010 Populus trichoca... 34 5.4
gb|CN520559.1|CN520559 GQ0107.B3_G18 GQ010 Populus trichoca... 34 5.4
gb|CN520746.1|CN520746 GQ0107.B3_K02 GQ010 Populus trichoca... 34 5.4
gb|CN520964.1|CN520964 GQ0105.B3_K17 GQ010 Populus trichoca... 34 5.4
gb|CN521234.1|CN521234 GQ0113.B3_A20 GQ011 Populus trichoca... 34 5.4
gb|CN523656.1|CN523656 GQ015M09.T3_F08 GQ015 Populus tricho... 34 5.4
gb|CN523825.1|CN523825 GQ015M10.T3_F06 GQ015 Populus tricho... 34 5.4
gb|CN549774.1|CN549774 GQ0243.B3_J14 GQ024 Populus trichoca... 34 5.4
gb|CN549945.1|CN549945 GQ0241.B3_J16 GQ024 Populus trichoca... 34 5.4
gb|AJ767895.1|AJ767895 AJ767895 Populus euphratica leaf adu... 34 5.4
gb|AJ767987.1|AJ767987 AJ767987 Populus euphratica leaf adu... 34 5.4
gb|AJ769558.1|AJ769558 AJ769558 Populus euphratica leaf 3-6... 34 5.4
gb|AJ771989.1|AJ771989 AJ771989 Populus euphratica root 3-6... 34 5.4
gb|AJ773398.1|AJ773398 AJ773398 Populus euphratica shoot 3-... 34 5.4
gb|AJ775749.1|AJ775749 AJ775749 Populus euphratica root 3-6... 34 5.4
gb|AJ776035.1|AJ776035 AJ776035 Populus euphratica root 3-6... 34 5.4
gb|AJ776780.1|AJ776780 AJ776780 Populus euphratica root 3-6... 34 5.4
gb|AJ777529.1|AJ777529 AJ777529 Populus euphratica root 3-6... 34 5.4
gb|AJ777735.1|AJ777735 AJ777735 Populus euphratica root 3-6... 34 5.4
gb|AJ780099.1|AJ780099 AJ780099 Populus euphratica root 3-6... 34 5.4
gb|CV130585.1|CV130585 B9SP06a03 Populus stem seasonal libr... 34 5.4
gb|CV225364.1|CV225364 WS0161.B21_C22 PT-DX-A-7 Populus tri... 34 5.4
gb|CV225469.1|CV225469 WS0161.B21_H22 PT-DX-A-7 Populus tri... 34 5.4
gb|CV225688.1|CV225688 WS0162.B21_B23 PT-DX-A-7 Populus tri... 34 5.4
gb|CV226316.1|CV226316 WS0163.B21_O14 PT-DX-A-7 Populus tri... 34 5.4
gb|CV226507.1|CV226507 WS0164.B21_H14 PT-DX-A-7 Populus tri... 34 5.4
gb|CV227160.1|CV227160 WS0166.B21_G02 PT-DX-A-7 Populus tri... 34 5.4
gb|CV227392.1|CV227392 WS0167.B21_A22 PT-DX-A-7 Populus tri... 34 5.4
gb|CV228520.1|CV228520 WS01910.B21_G13 PT-DX-N-A-10 Populus... 34 5.4
gb|CV229294.1|CV229294 WS01912.B21_N09 PT-DX-N-A-10 Populus... 34 5.4
gb|CV229931.1|CV229931 WS01914.B21_O12 PT-DX-N-A-10 Populus... 34 5.4
gb|CV234158.1|CV234158 WS01213.B21_N11 PT-GT-FL-A-3 Populus... 34 5.4
gb|CV234159.1|CV234159 WS01213.B21_N13 PT-GT-FL-A-3 Populus... 34 5.4
gb|CV234562.1|CV234562 WS01215.B21.1_F16 PT-GT-FL-A-3 Popul... 34 5.4
gb|CV234704.1|CV234704 WS01215.B21.1_O13 PT-GT-FL-A-3 Popul... 34 5.4
gb|CV237521.1|CV237521 WS0123.B21_B14 PT-GT-FL-A-3 Populus ... 34 5.4
gb|CV239349.1|CV239349 WS0232.B21_C01 PT-MB-A-13 Populus tr... 34 5.4
gb|CV239726.1|CV239726 WS0233.B21_E16 PT-MB-A-13 Populus tr... 34 5.4
gb|CV239998.1|CV239998 WS0234.B21_B17 PT-MB-A-13 Populus tr... 34 5.4
gb|CV240076.1|CV240076 WS0234.B21_F07 PT-MB-A-13 Populus tr... 34 5.4
gb|CV244121.1|CV244121 WS0253.B21_M18 PT-MB-N-A-15 Populus ... 34 5.4
gb|CV246067.1|CV246067 WS0111.B21_C19 PT-P-FL-A-2 Populus t... 34 5.4
gb|CV247129.1|CV247129 WS01117.B21_B24 PT-P-FL-A-2 Populus ... 34 5.4
gb|CV249824.1|CV249824 WS01125.B21_G19 PT-P-FL-A-2 Populus ... 34 5.4
gb|CV250948.1|CV250948 WS0115.B21_F15 PT-P-FL-A-2 Populus t... 34 5.4
gb|CV251324.1|CV251324 WS0116.B21_J20 PT-P-FL-A-2 Populus t... 34 5.4
gb|CV254581.1|CV254581 WS0241.B21_J22 PTxD-ICC-N-A-14 Popul... 34 5.4
gb|CV256739.1|CV256739 WS0244.B21_K20 PTxD-ICC-N-A-14 Popul... 34 5.4
gb|CV257939.1|CV257939 WS0248.B21_B02 PTxD-ICC-N-A-14 Popul... 34 5.4
gb|CV258258.1|CV258258 WS0249.B21_A08 PTxD-ICC-N-A-14 Popul... 34 5.4
gb|CV259256.1|CV259256 WS02010.B21_N18 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV261406.1|CV261406 WS02016.B21_L02 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV263486.1|CV263486 WS02021.B21_P11 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV263566.1|CV263566 WS02022.B21_D05 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV264420.1|CV264420 WS02024.B21_H17 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV264849.1|CV264849 WS02025.B21_K13 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV265255.1|CV265255 WS02026.B21_M03 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV265680.1|CV265680 WS02027.B21_P01 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV265973.1|CV265973 WS02028.B21_M08 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV266040.1|CV266040 WS02028.B21_P06 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV266163.1|CV266163 WS02029.B21_E10 PTxN-IB-N-A-11 Popul... 34 5.4
gb|CV268299.1|CV268299 WS0205.B21_B15 PTxN-IB-N-A-11 Populu... 34 5.4
gb|CV268659.1|CV268659 WS0206.B21_B12 PTxN-IB-N-A-11 Populu... 34 5.4
gb|CV270094.1|CV270094 WS0151.B21_B04 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV270444.1|CV270444 WS0152.B21_A06 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV270896.1|CV270896 WS0153.B21_D20 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV270957.1|CV270957 WS0153.B21_G11 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV271292.1|CV271292 WS0154.B21_E21 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV271427.1|CV271427 WS0154.B21_K21 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV271713.1|CV271713 WS0155.B21_H08 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV272503.1|CV272503 WS0157.B21_N12 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV272698.1|CV272698 WS0158.B21_H03 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV272710.1|CV272710 WS0158.B21_H15 PTxN-IB-A-6 Populus t... 34 5.4
gb|CV272893.1|CV272893 WS0171.B21_A14 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV272989.1|CV272989 WS0171.B21_F05 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV273320.1|CV273320 WS01710.B21_I09 PTxD-NR-A-8 Populus ... 34 5.4
gb|CV273880.1|CV273880 WS01712.B21_H20 PTxD-NR-A-8 Populus ... 34 5.4
gb|CV274751.1|CV274751 WS0174.B21.1_E09 PTxD-NR-A-8 Populus... 34 5.4
gb|CV274766.1|CV274766 WS0174.B21.1_F05 PTxD-NR-A-8 Populus... 34 5.4
gb|CV274798.1|CV274798 WS0174.B21.1_G18 PTxD-NR-A-8 Populus... 34 5.4
gb|CV275159.1|CV275159 WS0175.B21_I23 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV275230.1|CV275230 WS0175.B21_M16 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV275337.1|CV275337 WS0176.B21_C06 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV275483.1|CV275483 WS0176.B21_J19 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV275655.1|CV275655 WS0177.B21_D03 PTxD-NR-A-8 Populus t... 34 5.4
gb|CV277905.1|CV277905 WS0144.B21_O09 PTxD-IL-A-5 Populus t... 34 5.4
gb|CV281327.1|CV281327 WS0181.B21_K02 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CV282259.1|CV282259 WS0184.B21_C09 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CV282587.1|CV282587 WS0185.B21_A16 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CV282666.1|CV282666 WS0185.B21_E08 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CV282797.1|CV282797 WS0185.B21_K01 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CV283214.1|CV283214 WS0186.B21_L19 PTxD-IL-N-A-9 Populus... 34 5.4
gb|CF936498.1|CF936498 PO3006G02 Populus tomentiglandulosa ... 34 5.4
gb|CF936640.1|CF936640 PO3008E01 Populus tomentiglandulosa ... 34 5.4
gb|CX168120.1|CX168120 D03_69-116_07.ab1 leaf inoculated wi... 34 5.4
gb|CX170106.1|CX170106 D09_69-57_07.ab1 leaf inoculated wit... 34 5.4
gb|CX170470.1|CX170470 B06_69-103_04.ab1 leaf inoculated wi... 34 5.4
gb|CX172412.1|CX172412 B03_69-76_03.ab1 leaf inoculated wit... 34 5.4
gb|CX173544.1|CX173544 D06_69-98_08.ab1 leaf inoculated wit... 34 5.4
gb|CX174194.1|CX174194 C10_69-113_06.ab1 leaf inoculated wi... 34 5.4
gb|CX174407.1|CX174407 F10_69-9_12.ab1 leaf inoculated with... 34 5.4
gb|CX174722.1|CX174722 E03_69-74_09.ab1 leaf inoculated wit... 34 5.4
gb|CX175192.1|CX175192 D12_69-48_08.ab1 leaf inoculated wit... 34 5.4
gb|CX175246.1|CX175246 C11_69-121_05.ab1 leaf inoculated wi... 34 5.4
gb|CX175294.1|CX175294 H05_69-19_15.ab1 leaf inoculated wit... 34 5.4
gb|CX175832.1|CX175832 A10_69-36_02.ab1 leaf inoculated wit... 34 5.4
gb|CX175948.1|CX175948 C12_69-7_06.ab1 leaf inoculated with... 34 5.4
gb|CX176130.1|CX176130 D12_69-69_08.ab1 leaf inoculated wit... 34 5.4
gb|CX176192.1|CX176192 C09_69-70_05.ab1 leaf inoculated wit... 34 5.4
gb|CX177108.1|CX177108 H08_69-101_16.ab1 leaf inoculated wi... 34 5.4
gb|CX177481.1|CX177481 E12_45-109_10.ab1 leaf inoculated wi... 34 5.4
gb|CX178923.1|CX178923 G07_45-51_13.ab1 leaf inoculated wit... 34 5.4
gb|CX179315.1|CX179315 B04_45-123_04.ab1 leaf inoculated wi... 34 5.4
gb|CX179780.1|CX179780 E04_45-31_10.ab1 leaf inoculated wit... 34 5.4
gb|CX182204.1|CX182204 C02_45-35_06.ab1 leaf inoculated wit... 34 5.4
gb|CX184243.1|CX184243 E09_45-114_09.ab1 leaf inoculated wi... 34 5.4
gb|CX186565.1|CX186565 F01_45-18_11.ab1 leaf inoculated wit... 34 5.4
gb|CX659216.1|CX659216 PO01027H07 Poplar SC cDNA library Po... 34 5.4
gb|BP929915.1|BP929915 BP929915 full-length enriched poplar... 34 5.4
gb|BP931197.1|BP931197 BP931197 full-length enriched poplar... 34 5.4
gb|DN487267.1|DN487267 Q021F02.3pR Populus dormant bud cDNA... 34 5.4
gb|DN494476.1|DN494476 K068P33.5pR Populus apical shoot cDN... 34 5.4
gb|DN496884.1|DN496884 Q021F02.5pR Populus dormant bud cDNA... 34 5.4
gb|DT469901.1|DT469901 WS01919.C21_E04 PT-DX-N-A-10 Populus... 34 5.4
gb|DT471439.1|DT471439 WS01213.BR_N11 PT-GT-FL-A-3 Populus ... 34 5.4
gb|DT471440.1|DT471440 WS01213.BR_N13 PT-GT-FL-A-3 Populus ... 34 5.4
gb|DT473000.1|DT473000 WS01228.BR_E06 PT-GT-FL-A-3 Populus ... 34 5.4
gb|DT473584.1|DT473584 WS0123.BR_B14 PT-GT-FL-A-3 Populus t... 34 5.4
gb|DT476090.1|DT476090 WS01228.B21_E06 PT-GT-FL-A-3 Populus... 34 5.4
gb|DT480239.1|DT480239 WS02528.BR_F02 PT-MB-N-A-15 Populus ... 34 5.4
gb|DT485473.1|DT485473 WS02528.B21_F02 PT-MB-N-A-15 Populus... 34 5.4
gb|DT489403.1|DT489403 WS02542.B21_C03 PT-MB-N-A-15 Populus... 34 5.4
gb|DT493372.1|DT493372 WS0111.BR_C19 PT-P-FL-A-2 Populus tr... 34 5.4
gb|DT494001.1|DT494001 WS01117.BR_B24 PT-P-FL-A-2 Populus t... 34 5.4
gb|DT497077.1|DT497077 WS01125.BR_G19 PT-P-FL-A-2 Populus t... 34 5.4
gb|DT498435.1|DT498435 WS0115.BR_F15 PT-P-FL-A-2 Populus tr... 34 5.4
gb|DT498877.1|DT498877 WS0116.BR_J20 PT-P-FL-A-2 Populus tr... 34 5.4
gb|DT499048.1|DT499048 WS0117.BR_B18 PT-P-FL-A-2 Populus tr... 34 5.4
gb|DT501464.1|DT501464 WS01312.BR_O16 PTxD-IL-FL-A-4 Populu... 34 5.4
gb|DT501876.1|DT501876 WS01314.BR_I19 PTxD-IL-FL-A-4 Populu... 34 5.4
gb|DT502320.1|DT502320 WS0132.BR_H24 PTxD-IL-FL-A-4 Populus... 34 5.4
gb|DT502907.1|DT502907 WS0134.BR_L01 PTxD-IL-FL-A-4 Populus... 34 5.4
gb|DT504325.1|DT504325 WS01312.B21_O16 PTxD-IL-FL-A-4 Popul... 34 5.4
gb|DT504743.1|DT504743 WS01314.B21_I19 PTxD-IL-FL-A-4 Popul... 34 5.4
gb|DT505775.1|DT505775 WS01811.C21_N05 PTxD-IL-N-A-9 Populu... 34 5.4
gb|DT517160.1|DT517160 WS02433.B21_H21 PTxD-ICC-N-A-14 Popu... 34 5.4
gb|DT519516.1|DT519516 WS02441.B21_N13 PTxD-ICC-N-A-14 Popu... 34 5.4
gb|DT523232.1|DT523232 WS02039.B21_C13 PTxN-IB-N-A-11 Popul... 34 5.4
gb|DT523268.1|DT523268 WS02039.B21_E01 PTxN-IB-N-A-11 Popul... 34 5.4
gb|DT523319.1|DT523319 WS02039.B21_G05 PTxN-IB-N-A-11 Popul... 34 5.4
gb|DT524269.1|DT524269 WS02042.C21.1_C01 PTxN-IB-N-A-11 Pop... 34 5.4
gb|DT524830.1|DT524830 WS02043.C21_L09 PTxN-IB-N-A-11 Popul... 34 5.4
>gb|CF235641.1|CF235641 PtaJXT0025C2C0206 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 688
Score = 36.2 bits (18), Expect = 1.4
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 282 atggtcatcagaggaagatgag 303
||||||| ||||||||||||||
Sbjct: 231 atggtcaccagaggaagatgag 252
>gb|DT481229.1|DT481229 WS02531.BR_E10 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02531_E10 5', mRNA sequence
Length = 597
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 132 ggttgctgaagacatgtt 149
||||||||||||||||||
Sbjct: 1 ggttgctgaagacatgtt 18
>gb|DT486541.1|DT486541 WS02531.B21_E10 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02531_E10 3', mRNA sequence
Length = 597
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 132 ggttgctgaagacatgtt 149
||||||||||||||||||
Sbjct: 597 ggttgctgaagacatgtt 580
>gb|AI162807.1|AI162807 A024P43U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 413
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 84 gttgctgaagacatgtt 100
>gb|AI163006.1|AI163006 A028P62U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 450
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 66 gttgctgaagacatgtt 82
>gb|AI163173.1|AI163173 A034p4u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 364
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 153 gttgctgaagacatgtt 169
>gb|AI163390.1|AI163390 A041P05U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 312
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 86 gttgctgaagacatgtt 102
>gb|AI163569.1|AI163569 A044P53U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 434
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 186 gttgctgaagacatgtt 202
>gb|AI163998.1|AI163998 A052p30u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 329
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 122 gttgctgaagacatgtt 138
>gb|AI164056.1|AI164056 A053P80U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 342
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 164 gttgctgaagacatgtt 180
>gb|AI164845.1|AI164845 A069p61u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 324
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 103 gttgctgaagacatgtt 119
>gb|AI164879.1|AI164879 A070P22U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 358
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 90 gttgctgaagacatgtt 106
>gb|AI165466.1|AI165466 A084P46U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 409
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 72 gttgctgaagacatgtt 88
>gb|AI165762.1|AI165762 A090P55U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 388
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 120 gttgctgaagacatgtt 136
>gb|AI165844.1|AI165844 A092P66U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 302
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 77 gttgctgaagacatgtt 93
>gb|BI068607.1|BI068607 C024P48U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 399
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 260 gttgctgaagacatgtt 276
>gb|BI069559.1|BI069559 C003P18U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 389
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 107 gttgctgaagacatgtt 123
>gb|BI071690.1|BI071690 C062P34U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 378
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 174 gttgctgaagacatgtt 190
>gb|BI072137.1|BI072137 C070P10U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 397
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 148 gttgctgaagacatgtt 164
>gb|BI072776.1|BI072776 C087P10U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 399
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 31 gttgctgaagacatgtt 47
>gb|BI119644.1|BI119644 F002P95Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 441
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 127 gttgctgaagacatgtt 143
>gb|BI119707.1|BI119707 F003P86Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 326
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 145 gttgctgaagacatgtt 161
>gb|BI120327.1|BI120327 F013P52Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 347
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 166 gttgctgaagacatgtt 182
>gb|BI121914.1|BI121914 F049P74Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 288
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 165 gttgctgaagacatgtt 181
>gb|BI122000.1|BI122000 F051P21Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 281
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 129 gttgctgaagacatgtt 145
>gb|BI123282.1|BI123282 I020P72P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 409
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 67 gttgctgaagacatgtt 83
>gb|BI123293.1|BI123293 I021P01P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 480
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 172 gttgctgaagacatgtt 188
>gb|BI124562.1|BI124562 I046P73P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 370
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 187 gttgctgaagacatgtt 203
>gb|BI124702.1|BI124702 I049P63P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 367
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 205 gagatagagggacctcc 221
|||||||||||||||||
Sbjct: 276 gagatagagggacctcc 260
>gb|BI125140.1|BI125140 I056P35P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 548
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 137 gttgctgaagacatgtt 153
>gb|BI125256.1|BI125256 I058P05P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 560
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 85 gttgctgaagacatgtt 101
>gb|BI129592.1|BI129592 G092P94Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 309
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 137 gttgctgaagacatgtt 153
>gb|BI130339.1|BI130339 G104P12Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 403
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 16 gttgctgaagacatgtt 32
>gb|BI139345.1|BI139345 F129P76Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 529
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 132 gttgctgaagacatgtt 148
>gb|BU809140.1|BU809140 UL54PC01 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 462
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 218 gttgctgaagacatgtt 234
>gb|BU809516.1|BU809516 UL58TG04 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 608
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 141 gttgctgaagacatgtt 157
>gb|BU810271.1|BU810271 UL68E02 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 425
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 137 gttgctgaagacatgtt 153
>gb|BU810521.1|BU810521 UL71PF01 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 485
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 210 gttgctgaagacatgtt 226
>gb|BU811351.1|BU811351 UL83TB12 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 610
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 217 gttgctgaagacatgtt 233
>gb|BU811575.1|BU811575 UL86TA10 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 560
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 159 gttgctgaagacatgtt 175
>gb|BU811882.1|BU811882 UL89TF07 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 423
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 301 gttgctgaagacatgtt 317
>gb|BU812264.1|BU812264 UL94TB10 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 453
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 130 gttgctgaagacatgtt 146
>gb|BU813152.1|BU813152 N005H07 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 616
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 218 gttgctgaagacatgtt 234
>gb|BU821948.1|BU821948 UB31BPA02 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 467
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 183 gttgctgaagacatgtt 199
>gb|BU822182.1|BU822182 UB33BPE08 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 357
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 159 gttgctgaagacatgtt 175
>gb|BU822199.1|BU822199 UB33BPG02 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 330
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 135 gttgctgaagacatgtt 151
>gb|BU822816.1|BU822816 UB43DPG12 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 493
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 213 gttgctgaagacatgtt 229
>gb|BU823918.1|BU823918 UB58DPB03 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 565
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 94 gttgctgaagacatgtt 110
>gb|BU824667.1|BU824667 UB67DPD09 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 441
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 153 gttgctgaagacatgtt 169
>gb|BU825429.1|BU825429 UK108TF05 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 580
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU826188.1|BU826188 UK117TF05 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 620
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 209 gttgctgaagacatgtt 225
>gb|BU827475.1|BU827475 K003P29P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 472
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 171 gttgctgaagacatgtt 187
>gb|BU828169.1|BU828169 K018P02P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 238
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 88 gttgctgaagacatgtt 104
>gb|BU828670.1|BU828670 K026P62P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 660
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 204 gttgctgaagacatgtt 220
>gb|BU828918.1|BU828918 K031P20P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 496
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 179 gttgctgaagacatgtt 195
>gb|BU829298.1|BU829298 K038P02P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 508
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 34 gttgctgaagacatgtt 50
>gb|BU831333.1|BU831333 T020C09 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 729
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 266 gttgctgaagacatgtt 282
>gb|BU832816.1|BU832816 T038E09 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 240
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 182 gttgctgaagacatgtt 198
>gb|BU833065.1|BU833065 T041D08 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 327
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 215 gttgctgaagacatgtt 231
>gb|BU833595.1|BU833595 T050B06 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 591
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 215 gttgctgaagacatgtt 231
>gb|BU834499.1|BU834499 T061H09 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 671
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 224 gttgctgaagacatgtt 240
>gb|BU834712.1|BU834712 T064G10 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 621
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 180 gttgctgaagacatgtt 196
>gb|BU835177.1|BU835177 T070E11 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 593
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 160 gttgctgaagacatgtt 176
>gb|BU835860.1|BU835860 T079E11 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 751
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 189 gttgctgaagacatgtt 205
>gb|BU836927.1|BU836927 T092F03 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 703
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU836937.1|BU836937 T092G02 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 621
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 223 gttgctgaagacatgtt 239
>gb|BU861444.1|BU861444 S002B06 Populus imbibed seed cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 708
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|BU865100.1|BU865100 S049B01 Populus imbibed seed cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 524
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU867403.1|BU867403 S077G10 Populus imbibed seed cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 683
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|BU868099.1|BU868099 M111C01 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 681
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU868399.1|BU868399 M115C08 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 563
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 167 gttgctgaagacatgtt 183
>gb|BU870122.1|BU870122 Q008I23 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 435
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 210 gttgctgaagacatgtt 226
>gb|BU870603.1|BU870603 Q015H02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 516
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 135 gttgctgaagacatgtt 151
>gb|BU871575.1|BU871575 Q032A12 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 651
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 135 gttgctgaagacatgtt 151
>gb|BU873523.1|BU873523 Q056E02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 223 gttgctgaagacatgtt 239
>gb|BU874255.1|BU874255 Q066A10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 496
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 217 gttgctgaagacatgtt 233
>gb|BU876411.1|BU876411 V020D01 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 659
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 130 gttgctgaagacatgtt 146
>gb|BU879347.1|BU879347 V059A12 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 744
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 181 gttgctgaagacatgtt 197
>gb|BU880176.1|BU880176 UM42TD09 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 552
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 162 gttgctgaagacatgtt 178
>gb|BU880254.1|BU880254 UM43TE02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 633
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 219 gttgctgaagacatgtt 235
>gb|BU880847.1|BU880847 UM55TF08 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 626
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 152 gttgctgaagacatgtt 168
>gb|BU881315.1|BU881315 UM61TB11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 601
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 171 gttgctgaagacatgtt 187
>gb|BU881434.1|BU881434 UM62TF06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 498
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|BU881516.1|BU881516 UM63TG06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 571
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 149 gttgctgaagacatgtt 165
>gb|BU882153.1|BU882153 UM73TC10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 581
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|BU882158.1|BU882158 UM73TD05 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 571
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 149 gttgctgaagacatgtt 165
>gb|BU882447.1|BU882447 UM77TB02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 569
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 155 gttgctgaagacatgtt 171
>gb|BU882468.1|BU882468 UM77TD01 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 579
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 210 gttgctgaagacatgtt 226
>gb|BU882720.1|BU882720 UM81TC11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 597
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 193 gttgctgaagacatgtt 209
>gb|BU882991.1|BU882991 UM84TH09 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 570
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 154 gttgctgaagacatgtt 170
>gb|BU882993.1|BU882993 UM84TH11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 580
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 154 gttgctgaagacatgtt 170
>gb|BU884762.1|BU884762 R015B09 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 671
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 195 gttgctgaagacatgtt 211
>gb|BU885467.1|BU885467 R031G01 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 587
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 152 gttgctgaagacatgtt 168
>gb|BU886373.1|BU886373 R044E10 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 371
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 131 gttgctgaagacatgtt 147
>gb|BU886886.1|BU886886 R051G10 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 531
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 189 gttgctgaagacatgtt 205
>gb|BU889043.1|BU889043 P016A03 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 640
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 131 gttgctgaagacatgtt 147
>gb|BU889706.1|BU889706 P024F02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 471
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|BU890697.1|BU890697 P040E07 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 683
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU891338.1|BU891338 P048H05 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 400
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 204 gttgctgaagacatgtt 220
>gb|BU891842.1|BU891842 P055H01 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 681
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|BU892038.1|BU892038 P058E10 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 528
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 157 gttgctgaagacatgtt 173
>gb|BU893158.1|BU893158 P074A08 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 701
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 217 gttgctgaagacatgtt 233
>gb|BU893299.1|BU893299 P075H08 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 440
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 162 gttgctgaagacatgtt 178
>gb|BU893664.1|BU893664 P080G02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 587
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 189 gttgctgaagacatgtt 205
>gb|BU893802.1|BU893802 P082G12 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 424
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 153 gttgctgaagacatgtt 169
>gb|BU896114.1|BU896114 X035G03 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 644
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 52 gttgctgaagacatgtt 68
>gb|CA925117.1|CA925117 MTU7TL.P13.G04 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 676
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 374 gaaatgccaactcatgc 390
|||||||||||||||||
Sbjct: 289 gaaatgccaactcatgc 305
>gb|CA927622.1|CA927622 MTU6TR.P11.B03 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 463
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 302 gttgctgaagacatgtt 286
>gb|CA930377.1|CA930377 MTU4CA.P21.H02 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 408
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 107 gttgctgaagacatgtt 123
>gb|CA822880.1|CA822880 R15B11 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 275
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 178 gttgctgaagacatgtt 194
>gb|CA823960.1|CA823960 R34B02 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 279
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 182 gttgctgaagacatgtt 198
>gb|CA825476.1|CA825476 R59F07 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 574
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 131 gttgctgaagacatgtt 147
>gb|CB239419.1|CB239419 RSH11A06 two-month-old roots from clone 'Beaupre' grown for 19 days
under restricted irrigation Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 596
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 215 gttgctgaagacatgtt 231
>gb|CB239672.1|CB239672 RSH15B08 two-month-old roots from clone 'Beaupre' grown for 19 days
under restricted irrigation Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 566
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 222 gttgctgaagacatgtt 238
>gb|CB833338.1|CB833338 R01G09 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 499
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|CF230552.1|CF230552 PtaC0009G4G0414 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 712
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 162 gttgctgaagacatgtt 178
>gb|CF231133.1|CF231133 PtaC0017G2G0214 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 648
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 234 gttgctgaagacatgtt 250
>gb|CF231670.1|CF231670 PtaC0024C4C0406 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 747
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 219 gttgctgaagacatgtt 235
>gb|CF231829.1|CF231829 PtaC0026C7C0705 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 219 gttgctgaagacatgtt 235
>gb|CF232518.1|CF232518 PtaJXO0011D9D0907 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 661
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 161 gttgctgaagacatgtt 177
>gb|CF232668.1|CF232668 PtaJXO0014C4C0406 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 577
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 216 gttgctgaagacatgtt 232
>gb|CF233945.1|CF233945 PtaJXO0029E3E0309 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 567
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 155 gttgctgaagacatgtt 171
>gb|CF234014.1|CF234014 PtaJXO1D6D0608 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 772
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 205 gttgctgaagacatgtt 221
>gb|CF234969.1|CF234969 PtaJXT0017C7C0705 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 772
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 217 gttgctgaagacatgtt 233
>gb|CF235367.1|CF235367 PtaJXT0022A2A0202 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 751
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 211 gttgctgaagacatgtt 227
>gb|CF236446.1|CF236446 PtaJXT2H1H0115 Poplar cDNA library from young tension xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 698
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 50 gttgctgaagacatgtt 66
>gb|CF236619.1|CF236619 PtaJXT5A3A0301 Poplar cDNA library from young tension xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 504
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 164 gttgctgaagacatgtt 180
>gb|CF236910.1|CF236910 PtaJXT8F6F0612 Poplar cDNA library from young tension xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 604
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 201 gttgctgaagacatgtt 217
>gb|CF236944.1|CF236944 PtaJXT9A6A0602 Poplar cDNA library from young tension xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 632
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 52 gttgctgaagacatgtt 68
>gb|CF237185.1|CF237185 Ptajxtjxt3A9A0901 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 742
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 155 gttgctgaagacatgtt 171
>gb|CK089459.1|CK089459 C011P45.3pR Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA clone C011P45 3', mRNA sequence
Length = 257
Score = 34.2 bits (17), Expect = 5.4
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 502 aaaatggtcaaacatttccca 522
|||||||| ||||||||||||
Sbjct: 123 aaaatggttaaacatttccca 143
>gb|CK094958.1|CK094958 I063P07.3pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I063P07 3', mRNA sequence
Length = 673
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 124 tcagatgaggttgctga 140
|||||||||||||||||
Sbjct: 142 tcagatgaggttgctga 158
>gb|CK095513.1|CK095513 UA12BPA05.3pR Populus dormant cambium cDNA library Populus tremula
cDNA clone UA12BPA05 3', mRNA sequence
Length = 447
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 166 catgaaactgtgggact 182
|||||||||||||||||
Sbjct: 226 catgaaactgtgggact 242
>gb|CK098811.1|CK098811 A034P04.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A034P04 5', mRNA sequence
Length = 442
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 180 gttgctgaagacatgtt 196
>gb|CK098945.1|CK098945 A044P53.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A044P53 5', mRNA sequence
Length = 323
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 203 gttgctgaagacatgtt 219
>gb|CK099788.1|CK099788 A084P46.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A084P46 5', mRNA sequence
Length = 494
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 142 gttgctgaagacatgtt 158
>gb|CK109299.1|CK109299 K068P33 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA clone K068P33 5', mRNA sequence
Length = 282
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 170 gttgctgaagacatgtt 186
>gb|CK109584.1|CK109584 N019C05 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N019C05 5', mRNA sequence
Length = 796
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 220 gttgctgaagacatgtt 236
>gb|CK110345.1|CK110345 N055H08 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N055H08 5', mRNA sequence
Length = 436
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 155 gttgctgaagacatgtt 171
>gb|CK110502.1|CK110502 N067D03 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N067D03 5', mRNA sequence
Length = 592
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 162 gttgctgaagacatgtt 178
>gb|CK111067.1|CK111067 Q008E12 Populus dormant bud cDNA library Populus tremula cDNA clone
Q008E12 5', mRNA sequence
Length = 567
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 201 gttgctgaagacatgtt 217
>gb|CK115750.1|CK115750 Y014H02 Populus infected leaf substracted cDNA library Populus
tremula cDNA clone Y014H02 5', mRNA sequence
Length = 533
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 229 gttgctgaagacatgtt 245
>gb|CK116274.1|CK116274 A034P04 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A034P04 5', mRNA sequence
Length = 364
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 153 gttgctgaagacatgtt 169
>gb|CK116386.1|CK116386 B011P11 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone B011P11 5', mRNA sequence
Length = 369
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 201 gttgctgaagacatgtt 217
>gb|CK116702.1|CK116702 B016P10 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone B016P10 5', mRNA sequence
Length = 331
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 122 gttgctgaagacatgtt 138
>gb|CN193422.1|CN193422 PtdH942 hybrid poplar systemically wound-induced leaf cDNA library
Populus trichocarpa x Populus deltoides cDNA 5, mRNA
sequence
Length = 502
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 99 gttgctgaagacatgtt 115
>gb|CN517993.1|CN517993 GQ0091.B3_B01 GQ009 Populus trichocarpa x Populus deltoides cDNA
clone GQ0091_B01 5', mRNA sequence
Length = 534
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 172 gttgctgaagacatgtt 188
>gb|CN518091.1|CN518091 GQ0092.B3_N14 GQ009 Populus trichocarpa x Populus deltoides cDNA
clone GQ0092_N14 5', mRNA sequence
Length = 546
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 150 gttgctgaagacatgtt 166
>gb|CN518665.1|CN518665 GQ0102.B3_L08 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0102_L08 5', mRNA sequence
Length = 632
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 56 gttgctgaagacatgtt 72
>gb|CN519337.1|CN519337 GQ0102.B3_M05 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0102_M05 5', mRNA sequence
Length = 607
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 174 gttgctgaagacatgtt 190
>gb|CN519570.1|CN519570 GQ0102.B3_F11 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0102_F11 5', mRNA sequence
Length = 656
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 166 gttgctgaagacatgtt 182
>gb|CN520559.1|CN520559 GQ0107.B3_G18 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0107_G18 5', mRNA sequence
Length = 703
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 191 gttgctgaagacatgtt 207
>gb|CN520746.1|CN520746 GQ0107.B3_K02 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0107_K02 5', mRNA sequence
Length = 830
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 115 gttgctgaagacatgtt 131
>gb|CN520964.1|CN520964 GQ0105.B3_K17 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0105_K17 5', mRNA sequence
Length = 828
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 201 gttgctgaagacatgtt 217
>gb|CN521234.1|CN521234 GQ0113.B3_A20 GQ011 Populus trichocarpa x Populus deltoides cDNA
clone GQ0113_A20 5', mRNA sequence
Length = 297
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 9 gttgctgaagacatgtt 25
>gb|CN523656.1|CN523656 GQ015M09.T3_F08 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M09_F08 5', mRNA sequence
Length = 777
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 177 gttgctgaagacatgtt 193
>gb|CN523825.1|CN523825 GQ015M10.T3_F06 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M10_F06 5', mRNA sequence
Length = 818
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 196 gttgctgaagacatgtt 212
>gb|CN549774.1|CN549774 GQ0243.B3_J14 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0243_J14 5', mRNA sequence
Length = 654
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 179 gttgctgaagacatgtt 195
>gb|CN549945.1|CN549945 GQ0241.B3_J16 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0241_J16 5', mRNA sequence
Length = 807
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 194 gttgctgaagacatgtt 210
>gb|AJ767895.1|AJ767895 AJ767895 Populus euphratica leaf adult Populus euphratica cDNA
clone P0000100011G01F1, mRNA sequence
Length = 706
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 192 gttgctgaagacatgtt 208
>gb|AJ767987.1|AJ767987 AJ767987 Populus euphratica leaf adult Populus euphratica cDNA
clone P0000100012G10F1, mRNA sequence
Length = 548
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 163 gttgctgaagacatgtt 179
>gb|AJ769558.1|AJ769558 AJ769558 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0001000009E05F1, mRNA sequence
Length = 434
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 127 gttgctgaagacatgtt 143
>gb|AJ771989.1|AJ771989 AJ771989 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0001600013B05F1, mRNA sequence
Length = 418
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 111 gttgctgaagacatgtt 127
>gb|AJ773398.1|AJ773398 AJ773398 Populus euphratica shoot 3-6 months Populus euphratica
cDNA clone P0000300001G08F1, mRNA sequence
Length = 608
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 138 gttgctgaagacatgtt 154
>gb|AJ775749.1|AJ775749 AJ775749 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400005B10F1, mRNA sequence
Length = 620
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 172 gttgctgaagacatgtt 188
>gb|AJ776035.1|AJ776035 AJ776035 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400008D08F1, mRNA sequence
Length = 488
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 159 gttgctgaagacatgtt 175
>gb|AJ776780.1|AJ776780 AJ776780 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400018D08F1, mRNA sequence
Length = 441
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 160 gttgctgaagacatgtt 176
>gb|AJ777529.1|AJ777529 AJ777529 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400029E09F1, mRNA sequence
Length = 414
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 148 gttgctgaagacatgtt 164
>gb|AJ777735.1|AJ777735 AJ777735 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400034C12F1, mRNA sequence
Length = 636
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 63 gttgctgaagacatgtt 79
>gb|AJ780099.1|AJ780099 AJ780099 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000800011G06F1, mRNA sequence
Length = 656
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 188 gttgctgaagacatgtt 204
>gb|CV130585.1|CV130585 B9SP06a03 Populus stem seasonal library Populus deltoides cDNA,
mRNA sequence
Length = 815
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 246 gttgctgaagacatgtt 262
>gb|CV225364.1|CV225364 WS0161.B21_C22 PT-DX-A-7 Populus trichocarpa cDNA clone WS0161_C22
3', mRNA sequence
Length = 827
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 656 gttgctgaagacatgtt 640
>gb|CV225469.1|CV225469 WS0161.B21_H22 PT-DX-A-7 Populus trichocarpa cDNA clone WS0161_H22
3', mRNA sequence
Length = 810
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 629 gttgctgaagacatgtt 613
>gb|CV225688.1|CV225688 WS0162.B21_B23 PT-DX-A-7 Populus trichocarpa cDNA clone WS0162_B23
3', mRNA sequence
Length = 708
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 601 gttgctgaagacatgtt 585
>gb|CV226316.1|CV226316 WS0163.B21_O14 PT-DX-A-7 Populus trichocarpa cDNA clone WS0163_O14
3', mRNA sequence
Length = 789
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 622 gttgctgaagacatgtt 606
>gb|CV226507.1|CV226507 WS0164.B21_H14 PT-DX-A-7 Populus trichocarpa cDNA clone WS0164_H14
3', mRNA sequence
Length = 769
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 641 gttgctgaagacatgtt 625
>gb|CV227160.1|CV227160 WS0166.B21_G02 PT-DX-A-7 Populus trichocarpa cDNA clone WS0166_G02
3', mRNA sequence
Length = 811
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 617 gttgctgaagacatgtt 601
>gb|CV227392.1|CV227392 WS0167.B21_A22 PT-DX-A-7 Populus trichocarpa cDNA clone WS0167_A22
3', mRNA sequence
Length = 756
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 631 gttgctgaagacatgtt 615
>gb|CV228520.1|CV228520 WS01910.B21_G13 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01910_G13 3', mRNA sequence
Length = 655
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 562 gttgctgaagacatgtt 546
>gb|CV229294.1|CV229294 WS01912.B21_N09 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01912_N09 3', mRNA sequence
Length = 685
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 129 gttgctgaagacatgtt 145
>gb|CV229931.1|CV229931 WS01914.B21_O12 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01914_O12 3', mRNA sequence
Length = 670
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 623 gttgctgaagacatgtt 607
>gb|CV234158.1|CV234158 WS01213.B21_N11 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01213_N11 3', mRNA sequence
Length = 687
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 590 gttgctgaagacatgtt 574
>gb|CV234159.1|CV234159 WS01213.B21_N13 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01213_N13 3', mRNA sequence
Length = 676
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 658 gttgctgaagacatgtt 642
>gb|CV234562.1|CV234562 WS01215.B21.1_F16 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01215_F16 3', mRNA sequence
Length = 770
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 590 gttgctgaagacatgtt 574
>gb|CV234704.1|CV234704 WS01215.B21.1_O13 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01215_O13 3', mRNA sequence
Length = 872
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 679 gttgctgaagacatgtt 663
>gb|CV237521.1|CV237521 WS0123.B21_B14 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0123_B14 3', mRNA sequence
Length = 581
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 485 gttgctgaagacatgtt 469
>gb|CV239349.1|CV239349 WS0232.B21_C01 PT-MB-A-13 Populus trichocarpa cDNA clone WS0232_C01
3', mRNA sequence
Length = 746
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 598 gttgctgaagacatgtt 582
>gb|CV239726.1|CV239726 WS0233.B21_E16 PT-MB-A-13 Populus trichocarpa cDNA clone WS0233_E16
3', mRNA sequence
Length = 718
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 579 gttgctgaagacatgtt 563
>gb|CV239998.1|CV239998 WS0234.B21_B17 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_B17
3', mRNA sequence
Length = 726
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 635 gttgctgaagacatgtt 619
>gb|CV240076.1|CV240076 WS0234.B21_F07 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_F07
3', mRNA sequence
Length = 733
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 648 gttgctgaagacatgtt 632
>gb|CV244121.1|CV244121 WS0253.B21_M18 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0253_M18 3', mRNA sequence
Length = 594
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 62 gttgctgaagacatgtt 78
>gb|CV246067.1|CV246067 WS0111.B21_C19 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0111_C19 3', mRNA sequence
Length = 694
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 645 gttgctgaagacatgtt 629
>gb|CV247129.1|CV247129 WS01117.B21_B24 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01117_B24 3', mRNA sequence
Length = 760
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 592 gttgctgaagacatgtt 576
>gb|CV249824.1|CV249824 WS01125.B21_G19 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01125_G19 3', mRNA sequence
Length = 722
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 596 gttgctgaagacatgtt 580
>gb|CV250948.1|CV250948 WS0115.B21_F15 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0115_F15 3', mRNA sequence
Length = 670
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 654 gttgctgaagacatgtt 638
>gb|CV251324.1|CV251324 WS0116.B21_J20 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0116_J20 3', mRNA sequence
Length = 755
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 619 gttgctgaagacatgtt 603
>gb|CV254581.1|CV254581 WS0241.B21_J22 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0241_J22 3', mRNA sequence
Length = 781
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 606 gttgctgaagacatgtt 590
>gb|CV256739.1|CV256739 WS0244.B21_K20 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0244_K20 3', mRNA sequence
Length = 786
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 623 gttgctgaagacatgtt 607
>gb|CV257939.1|CV257939 WS0248.B21_B02 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0248_B02 3', mRNA sequence
Length = 756
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 713 gttgctgaagacatgtt 697
>gb|CV258258.1|CV258258 WS0249.B21_A08 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0249_A08 3', mRNA sequence
Length = 716
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 669 gttgctgaagacatgtt 653
>gb|CV259256.1|CV259256 WS02010.B21_N18 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02010_N18 3', mRNA sequence
Length = 684
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 563 gttgctgaagacatgtt 547
>gb|CV261406.1|CV261406 WS02016.B21_L02 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02016_L02 3', mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 598 gttgctgaagacatgtt 582
>gb|CV263486.1|CV263486 WS02021.B21_P11 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02021_P11 3', mRNA sequence
Length = 398
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 284 gttgctgaagacatgtt 268
>gb|CV263566.1|CV263566 WS02022.B21_D05 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02022_D05 3', mRNA sequence
Length = 821
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 735 gttgctgaagacatgtt 719
>gb|CV264420.1|CV264420 WS02024.B21_H17 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02024_H17 3', mRNA sequence
Length = 700
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 594 gttgctgaagacatgtt 578
>gb|CV264849.1|CV264849 WS02025.B21_K13 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02025_K13 3', mRNA sequence
Length = 714
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 607 gttgctgaagacatgtt 591
>gb|CV265255.1|CV265255 WS02026.B21_M03 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02026_M03 3', mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 598 gttgctgaagacatgtt 582
>gb|CV265680.1|CV265680 WS02027.B21_P01 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02027_P01 3', mRNA sequence
Length = 722
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 605 gttgctgaagacatgtt 589
>gb|CV265973.1|CV265973 WS02028.B21_M08 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02028_M08 3', mRNA sequence
Length = 761
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 650 gttgctgaagacatgtt 634
>gb|CV266040.1|CV266040 WS02028.B21_P06 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02028_P06 3', mRNA sequence
Length = 654
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 583 gttgctgaagacatgtt 567
>gb|CV266163.1|CV266163 WS02029.B21_E10 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02029_E10 3', mRNA sequence
Length = 759
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 635 gttgctgaagacatgtt 619
>gb|CV268299.1|CV268299 WS0205.B21_B15 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0205_B15 3', mRNA sequence
Length = 764
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 650 gttgctgaagacatgtt 634
>gb|CV268659.1|CV268659 WS0206.B21_B12 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0206_B12 3', mRNA sequence
Length = 698
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 650 gttgctgaagacatgtt 634
>gb|CV270094.1|CV270094 WS0151.B21_B04 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0151_B04 3', mRNA sequence
Length = 625
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 576 gttgctgaagacatgtt 560
>gb|CV270444.1|CV270444 WS0152.B21_A06 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0152_A06 3', mRNA sequence
Length = 844
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 656 gttgctgaagacatgtt 640
>gb|CV270896.1|CV270896 WS0153.B21_D20 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0153_D20 3', mRNA sequence
Length = 713
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 577 gttgctgaagacatgtt 561
>gb|CV270957.1|CV270957 WS0153.B21_G11 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0153_G11 3', mRNA sequence
Length = 712
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 580 gttgctgaagacatgtt 564
>gb|CV271292.1|CV271292 WS0154.B21_E21 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0154_E21 3', mRNA sequence
Length = 847
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 679 gttgctgaagacatgtt 663
>gb|CV271427.1|CV271427 WS0154.B21_K21 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0154_K21 3', mRNA sequence
Length = 771
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 622 gttgctgaagacatgtt 606
>gb|CV271713.1|CV271713 WS0155.B21_H08 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0155_H08 3', mRNA sequence
Length = 682
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 635 gttgctgaagacatgtt 619
>gb|CV272503.1|CV272503 WS0157.B21_N12 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0157_N12 3', mRNA sequence
Length = 724
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 598 gttgctgaagacatgtt 582
>gb|CV272698.1|CV272698 WS0158.B21_H03 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0158_H03 3', mRNA sequence
Length = 841
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 670 gttgctgaagacatgtt 654
>gb|CV272710.1|CV272710 WS0158.B21_H15 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0158_H15 3', mRNA sequence
Length = 770
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 575 gttgctgaagacatgtt 559
>gb|CV272893.1|CV272893 WS0171.B21_A14 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0171_A14 3', mRNA sequence
Length = 799
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 637 gttgctgaagacatgtt 621
>gb|CV272989.1|CV272989 WS0171.B21_F05 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0171_F05 3', mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 560 gttgctgaagacatgtt 544
>gb|CV273320.1|CV273320 WS01710.B21_I09 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS01710_I09 3', mRNA sequence
Length = 674
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 655 gttgctgaagacatgtt 639
>gb|CV273880.1|CV273880 WS01712.B21_H20 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS01712_H20 3', mRNA sequence
Length = 686
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 579 gttgctgaagacatgtt 563
>gb|CV274751.1|CV274751 WS0174.B21.1_E09 PTxD-NR-A-8 Populus trichocarpa x Populus
deltoides cDNA clone WS0174_E09 3', mRNA sequence
Length = 729
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 588 gttgctgaagacatgtt 572
>gb|CV274766.1|CV274766 WS0174.B21.1_F05 PTxD-NR-A-8 Populus trichocarpa x Populus
deltoides cDNA clone WS0174_F05 3', mRNA sequence
Length = 722
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 530 gttgctgaagacatgtt 514
>gb|CV274798.1|CV274798 WS0174.B21.1_G18 PTxD-NR-A-8 Populus trichocarpa x Populus
deltoides cDNA clone WS0174_G18 3', mRNA sequence
Length = 823
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 655 gttgctgaagacatgtt 639
>gb|CV275159.1|CV275159 WS0175.B21_I23 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0175_I23 3', mRNA sequence
Length = 828
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 670 gttgctgaagacatgtt 654
>gb|CV275230.1|CV275230 WS0175.B21_M16 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0175_M16 3', mRNA sequence
Length = 698
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 584 gttgctgaagacatgtt 568
>gb|CV275337.1|CV275337 WS0176.B21_C06 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0176_C06 3', mRNA sequence
Length = 814
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 672 gttgctgaagacatgtt 656
>gb|CV275483.1|CV275483 WS0176.B21_J19 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0176_J19 3', mRNA sequence
Length = 766
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 571 gttgctgaagacatgtt 555
>gb|CV275655.1|CV275655 WS0177.B21_D03 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0177_D03 3', mRNA sequence
Length = 809
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 637 gttgctgaagacatgtt 621
>gb|CV277905.1|CV277905 WS0144.B21_O09 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0144_O09 3', mRNA sequence
Length = 784
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 621 gttgctgaagacatgtt 605
>gb|CV281327.1|CV281327 WS0181.B21_K02 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0181_K02 3', mRNA sequence
Length = 844
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 673 gttgctgaagacatgtt 657
>gb|CV282259.1|CV282259 WS0184.B21_C09 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0184_C09 3', mRNA sequence
Length = 794
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 622 gttgctgaagacatgtt 606
>gb|CV282587.1|CV282587 WS0185.B21_A16 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0185_A16 3', mRNA sequence
Length = 840
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 669 gttgctgaagacatgtt 653
>gb|CV282666.1|CV282666 WS0185.B21_E08 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0185_E08 3', mRNA sequence
Length = 740
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 550 gttgctgaagacatgtt 534
>gb|CV282797.1|CV282797 WS0185.B21_K01 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0185_K01 3', mRNA sequence
Length = 799
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 635 gttgctgaagacatgtt 619
>gb|CV283214.1|CV283214 WS0186.B21_L19 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0186_L19 3', mRNA sequence
Length = 760
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 563 gttgctgaagacatgtt 547
>gb|CF936498.1|CF936498 PO3006G02 Populus tomentiglandulosa T. Lee cDNA library Populus
tomentiglandulosa cDNA, mRNA sequence
Length = 864
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 255 gttgctgaagacatgtt 271
>gb|CF936640.1|CF936640 PO3008E01 Populus tomentiglandulosa T. Lee cDNA library Populus
tomentiglandulosa cDNA, mRNA sequence
Length = 811
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 212 gttgctgaagacatgtt 228
>gb|CX168120.1|CX168120 D03_69-116_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 724
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 170 gttgctgaagacatgtt 186
>gb|CX170106.1|CX170106 D09_69-57_07.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 596
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 209 gttgctgaagacatgtt 225
>gb|CX170470.1|CX170470 B06_69-103_04.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 631
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 231 gttgctgaagacatgtt 247
>gb|CX172412.1|CX172412 B03_69-76_03.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 667
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 145 gttgctgaagacatgtt 161
>gb|CX173544.1|CX173544 D06_69-98_08.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 695
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 185 gttgctgaagacatgtt 201
>gb|CX174194.1|CX174194 C10_69-113_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 661
Score = 34.2 bits (17), Expect = 5.4
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 133 gttgctgaagacatgtt 149
|||||||||||||||||
Sbjct: 181 gttgctgaagacatgtt 197
Database: Populus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:31 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 67,956
Number of Sequences: 369679
Number of extensions: 67956
Number of successful extensions: 18940
Number of sequences better than 10.0: 303
Number of HSP's better than 10.0 without gapping: 303
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18603
Number of HSP's gapped (non-prelim): 337
length of query: 559
length of database: 203,408,664
effective HSP length: 19
effective length of query: 540
effective length of database: 196,384,763
effective search space: 106047772020
effective search space used: 106047772020
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)