BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.1
(689 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV231822.1|CV231822 WS0195.B21_K18 PT-DX-N-A-10 Populus ... 46 0.002
gb|CF232874.1|CF232874 PtaJXO0016G8G0814 Poplar cDNA librar... 42 0.027
gb|CK318930.1|CK318930 X9P04h10 Populus stem seasonal libra... 42 0.027
gb|AJ778757.1|AJ778757 AJ778757 Populus euphratica cambium ... 42 0.027
gb|CV242604.1|CV242604 WS02515.B21_I09 PT-MB-N-A-15 Populus... 40 0.11
gb|BU837261.1|BU837261 T096G03 Populus apical shoot cDNA li... 38 0.43
>gb|CV231822.1|CV231822 WS0195.B21_K18 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0195_K18 3', mRNA sequence
Length = 740
Score = 46.1 bits (23), Expect = 0.002
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 14 tgggcatatggcatgaacatgtttgatttgtctgggtggagaaagcaaaacatcaccgag 73
||||||||||| |||||||| ||||||||| | |||| | |||||||||||| ||
Sbjct: 738 tgggcatatggaatgaacatctttgatttgaaggaatggaagaggcaaaacatcactgat 679
Query: 74 gtctaccatacctggcagaagttgaat 100
|| || ||||| ||||||||| |||||
Sbjct: 678 gtatatcatacatggcagaagctgaat 652
>gb|CF232874.1|CF232874 PtaJXO0016G8G0814 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 758
Score = 42.1 bits (21), Expect = 0.027
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttga 39
||||||| || ||||||| || |||||||||||||||
Sbjct: 347 atgcttgcggatgggcatttgacatgaacatgtttga 383
>gb|CK318930.1|CK318930 X9P04h10 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 628
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 14 tgggcatatggcatgaacatgtttgattt 42
||||| |||||||||||||| ||||||||
Sbjct: 273 tgggcttatggcatgaacatatttgattt 301
>gb|AJ778757.1|AJ778757 AJ778757 Populus euphratica cambium 3-6 months Populus euphratica
cDNA clone P0000600005G03F1, mRNA sequence
Length = 435
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 14 tgggcatatggcatgaacatgtttgattt 42
||||| |||||||||||||| ||||||||
Sbjct: 362 tgggcttatggcatgaacatatttgattt 390
>gb|CV242604.1|CV242604 WS02515.B21_I09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02515_I09 3', mRNA sequence
Length = 904
Score = 40.1 bits (20), Expect = 0.11
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 8 tgtggttgggcatatggcatgaacatgtttgatttg 43
||||||||||||| ||| |||||| | |||||||||
Sbjct: 736 tgtggttgggcatttggaatgaacgtttttgatttg 701
>gb|BU837261.1|BU837261 T096G03 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 632
Score = 38.2 bits (19), Expect = 0.43
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 14 tgggcatatggcatgaacatgtttgat 40
||||||||||| |||||||| ||||||
Sbjct: 449 tgggcatatggaatgaacatatttgat 475
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 74,875
Number of Sequences: 369679
Number of extensions: 74875
Number of successful extensions: 18021
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18013
Number of HSP's gapped (non-prelim): 8
length of query: 689
length of database: 203,408,664
effective HSP length: 19
effective length of query: 670
effective length of database: 196,384,763
effective search space: 131577791210
effective search space used: 131577791210
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)