BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161285.2.2
(798 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI122281.1|BI122281 I004P65P Populus leaf cDNA library P... 42 0.032
gb|CA823251.1|CA823251 R23A11 two-month-old roots from clon... 42 0.032
gb|CK103910.1|CK103910 I004P65.5pR Populus senescing leaves... 42 0.032
gb|CK092919.1|CK092919 G100P11.3pR Populus tension wood cDN... 38 0.50
gb|CV228827.1|CV228827 WS01911.B21_F18 PT-DX-N-A-10 Populus... 38 0.50
gb|CX181022.1|CX181022 F07_45-15_11.ab1 leaf inoculated wit... 38 0.50
gb|DT469652.1|DT469652 WS01918.C21_H10 PT-DX-N-A-10 Populus... 38 0.50
>gb|BI122281.1|BI122281 I004P65P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 593
Score = 42.1 bits (21), Expect = 0.032
Identities = 44/52 (84%)
Strand = Plus / Plus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
|||||||||||||||| |||||||| ||||| ||||||||| ||||||
Sbjct: 207 attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 258
>gb|CA823251.1|CA823251 R23A11 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 536
Score = 42.1 bits (21), Expect = 0.032
Identities = 44/52 (84%)
Strand = Plus / Plus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
|||||||||||||||| |||||||| ||||| ||||||||| ||||||
Sbjct: 85 attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 136
>gb|CK103910.1|CK103910 I004P65.5pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I004P65 5', mRNA sequence
Length = 486
Score = 42.1 bits (21), Expect = 0.032
Identities = 44/52 (84%)
Strand = Plus / Plus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
|||||||||||||||| |||||||| ||||| ||||||||| ||||||
Sbjct: 209 attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 260
>gb|CK092919.1|CK092919 G100P11.3pR Populus tension wood cDNA library Populus tremula x
Populus tremuloides cDNA clone G100P11 3', mRNA sequence
Length = 807
Score = 38.2 bits (19), Expect = 0.50
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 377 tgaaaagccagctgagcaa 395
|||||||||||||||||||
Sbjct: 91 tgaaaagccagctgagcaa 109
>gb|CV228827.1|CV228827 WS01911.B21_F18 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01911_F18 3', mRNA sequence
Length = 765
Score = 38.2 bits (19), Expect = 0.50
Identities = 42/50 (84%)
Strand = Plus / Minus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
|||||||||||||| | | |||||||| ||||| ||||||||| ||||
Sbjct: 652 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 603
>gb|CX181022.1|CX181022 F07_45-15_11.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 512
Score = 38.2 bits (19), Expect = 0.50
Identities = 42/50 (84%)
Strand = Plus / Plus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
|||||||||||||| | | |||||||| ||||| ||||||||| ||||
Sbjct: 160 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 209
>gb|DT469652.1|DT469652 WS01918.C21_H10 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01918_H10 3', mRNA sequence
Length = 790
Score = 38.2 bits (19), Expect = 0.50
Identities = 42/50 (84%)
Strand = Plus / Minus
Query: 46 attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
|||||||||||||| | | |||||||| ||||| ||||||||| ||||
Sbjct: 652 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 603
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 72,175
Number of Sequences: 369679
Number of extensions: 72175
Number of successful extensions: 20668
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 20662
Number of HSP's gapped (non-prelim): 12
length of query: 798
length of database: 203,408,664
effective HSP length: 19
effective length of query: 779
effective length of database: 196,384,763
effective search space: 152983730377
effective search space used: 152983730377
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)