BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1738955.2.1
(1271 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF476071.1|CF476071 RTWW2_16_D03.g1_A021 Well-watered lo... 109 3e-022
gb|CF479898.1|CF479898 RTWW3_12_H04.g1_A022 Well-watered lo... 109 3e-022
gb|CO197872.1|CO197872 GEO1_9_E12.g1_A029 Root gravitropism... 109 3e-022
gb|CX649869.1|CX649869 COLD1_42_B01.b1_A029 Root cold Pinus... 109 3e-022
gb|CX649938.1|CX649938 COLD1_42_B01.g1_A029 Root cold Pinus... 109 3e-022
gb|DR181356.1|DR181356 RTMNUT1_38_A01.g2_A029 Roots minus m... 109 3e-022
gb|DR070227.1|DR070227 RTDK1_12_C03.b1_A029 Roots, dark Pin... 101 7e-020
gb|DR070312.1|DR070312 RTDK1_12_C03.g1_A029 Roots, dark Pin... 101 7e-020
gb|U64890.1|PTU64890 Pinus taeda expansin mRNA, partial cds 92 7e-017
gb|U64891.1|PTU64891 Pinus taeda expansin mRNA, partial cds 92 7e-017
gb|U64893.1|PTU64893 Pinus taeda expansin mRNA, partial cds 92 7e-017
gb|AF085330.1|AF085330 Pinus taeda expansin mRNA, complete cds 92 7e-017
gb|U64892.1|PTU64892 Pinus taeda expansin mRNA, partial cds 92 7e-017
gb|DR097316.1|DR097316 STRR1_33_H05.g3_A033 Stem Response R... 88 1e-015
gb|DR011201.1|DR011201 HEAT1_4_E06.b1_A029 Root at 37 C for... 78 1e-012
gb|DR047687.1|DR047687 RTBOR1_2_F07.g1_A029 Roots plus adde... 78 1e-012
gb|DR180723.1|DR180723 RTMNUT1_34_A06.g1_A029 Roots minus m... 78 1e-012
gb|CF477384.1|CF477384 RTWW3_7_A01.g1_A022 Well-watered lob... 74 2e-011
gb|CO367410.1|CO367410 RTK1_34_D03.b1_A029 Roots minus pota... 74 2e-011
gb|CO367487.1|CO367487 RTK1_34_D03.g1_A029 Roots minus pota... 74 2e-011
gb|CO369598.1|CO369598 RTK1_48_F01.b1_A029 Roots minus pota... 74 2e-011
gb|CO369680.1|CO369680 RTK1_48_F01.g1_A029 Roots minus pota... 74 2e-011
gb|CX648930.1|CX648930 COLD1_31_H02.g1_A029 Root cold Pinus... 74 2e-011
gb|DR050231.1|DR050231 RTBOR1_22_D04.b1_A029 Roots plus add... 74 2e-011
gb|DR050310.1|DR050310 RTBOR1_22_D04.g1_A029 Roots plus add... 74 2e-011
gb|DR051834.1|DR051834 RTBOR1_32_E10.g1_A029 Roots plus add... 74 2e-011
gb|DR093671.1|DR093671 STRR1_9_E07.g1_A033 Stem Response Re... 74 2e-011
gb|DR165660.1|DR165660 RTPHOS1_6_B10.g1_A029 Roots minus ph... 74 2e-011
gb|DR168497.1|DR168497 RTPHOS1_25_G11.g1_A029 Roots minus p... 74 2e-011
gb|DR683982.1|DR683982 EST1074058 Normalized pine embryo li... 74 2e-011
gb|DT631935.1|DT631935 EST1146866 Normalized pine embryo li... 74 2e-011
gb|DT632413.1|DT632413 EST1147344 Normalized pine embryo li... 74 2e-011
gb|DR010784.1|DR010784 HEAT1_1_F12.b1_A029 Root at 37 C for... 70 2e-010
gb|DR010861.1|DR010861 HEAT1_1_F12.g1_A029 Root at 37 C for... 70 2e-010
gb|DR120161.1|DR120161 RTMG1_27_H07.g2_A029 Roots minus mag... 68 1e-009
gb|DR120696.1|DR120696 RTMG1_31_G12.b1_A029 Roots minus mag... 68 1e-009
gb|CV144435.1|CV144435 EST855644 Sequencing ESTs from loblo... 66 4e-009
gb|DT624714.1|DT624714 EST1159049 Sequencing ESTs from lobl... 66 4e-009
gb|CF399941.1|CF399941 RTWW1_2_C11.b1_A015 Well-watered lob... 64 2e-008
gb|CX650634.1|CX650634 COLD1_47_B12.b1_A029 Root cold Pinus... 64 2e-008
gb|CX650703.1|CX650703 COLD1_47_B12.g1_A029 Root cold Pinus... 64 2e-008
gb|DR019211.1|DR019211 STRS1_28_B06.g1_A034 Shoot tip pitch... 64 2e-008
gb|CF471900.1|CF471900 RTDS1_7_A08.b1_A015 Drought-stressed... 62 6e-008
gb|CF471926.1|CF471926 RTDS1_7_A08.g1_A015 Drought-stressed... 62 6e-008
gb|CF668214.1|CF668214 RTCNT1_35_D04.b1_A029 Root control P... 62 6e-008
gb|CF668294.1|CF668294 RTCNT1_35_D04.g1_A029 Root control P... 62 6e-008
gb|DR051762.1|DR051762 RTBOR1_32_E10.b1_A029 Roots plus add... 62 6e-008
gb|DR096360.1|DR096360 STRR1_27_B05.g1_A033 Stem Response R... 62 6e-008
gb|DR119250.1|DR119250 RTMG1_22_C11.b1_A029 Roots minus mag... 62 6e-008
gb|DR119331.1|DR119331 RTMG1_22_C11.g1_A029 Roots minus mag... 62 6e-008
gb|DT624311.1|DT624311 EST1158586 Sequencing ESTs from lobl... 62 6e-008
gb|CO368672.1|CO368672 RTK1_42_C07.b1_A029 Roots minus pota... 60 2e-007
gb|CO368748.1|CO368748 RTK1_42_C07.g1_A029 Roots minus pota... 60 2e-007
gb|CV035793.1|CV035793 RTNACL1_42_B01.g1_A029 Roots plus ad... 60 2e-007
gb|DR071171.1|DR071171 RTDK1_18_C12.b1_A029 Roots, dark Pin... 60 2e-007
gb|BG039378.1|BG039378 NXSI_098_D11_F NXSI (Nsf Xylem Side ... 58 9e-007
gb|CF391855.1|CF391855 RTDR3_10_C05.g1_A022 Loblolly pine r... 58 9e-007
gb|CF400653.1|CF400653 RTWW1_6_A01.g1_A015 Well-watered lob... 58 9e-007
gb|CF475910.1|CF475910 RTWW2_15_D07.g1_A021 Well-watered lo... 58 9e-007
gb|CF663902.1|CF663902 RTCNT1_5_H12.g1_A029 Root control Pi... 58 9e-007
gb|CN784348.1|CN784348 EST783039 Sequencing ESTs from loblo... 58 9e-007
gb|CO172418.1|CO172418 NDL1_29_D02.g1_A029 Needles control ... 58 9e-007
gb|CX650764.1|CX650764 COLD1_48_A05.b1_A029 Root cold Pinus... 58 9e-007
gb|DR688987.1|DR688987 EST1079073 Normalized pine embryo li... 58 9e-007
gb|DR692635.1|DR692635 EST1082723 Normalized pine embryo li... 58 9e-007
gb|DT625757.1|DT625757 EST1157681 Sequencing ESTs from lobl... 58 9e-007
gb|AW290421.1|AW290421 NXNV020D02F Nsf Xylem Normal wood Ve... 56 4e-006
gb|BQ198383.1|BQ198383 NXLV130_C02_F NXLV (Nsf Xylem Late w... 56 4e-006
gb|CD027081.1|CD027081 NXNV020D02 Nsf Xylem Normal wood Ver... 56 4e-006
gb|DR055360.1|DR055360 RTCA1_23_E11.b1_A029 Roots minus cal... 56 4e-006
gb|DR055518.1|DR055518 RTCA1_24_E10.b1_A029 Roots minus cal... 56 4e-006
gb|DR684423.1|DR684423 EST1074500 Normalized pine embryo li... 56 4e-006
gb|DR692432.1|DR692432 EST1082520 Normalized pine embryo li... 56 4e-006
gb|CF666895.1|CF666895 RTCNT1_26_G11.g1_A029 Root control P... 54 1e-005
gb|CO171305.1|CO171305 NDL1_20_C09.g1_A029 Needles control ... 54 1e-005
gb|DR021085.1|DR021085 STRS1_42_F09.b1_A034 Shoot tip pitch... 54 1e-005
gb|DR021165.1|DR021165 STRS1_42_F09.g1_A034 Shoot tip pitch... 54 1e-005
gb|DR095411.1|DR095411 STRR1_20_G09.g1_A033 Stem Response R... 54 1e-005
gb|DR685073.1|DR685073 EST1075150 Normalized pine embryo li... 54 1e-005
gb|CF400025.1|CF400025 RTWW1_2_C11.g1_A015 Well-watered lob... 52 6e-005
gb|CO361349.1|CO361349 NDL2_4_G08.b1_A029 Needles control 2... 52 6e-005
gb|CO361435.1|CO361435 NDL2_4_G08.g1_A029 Needles control 2... 52 6e-005
gb|CX648594.1|CX648594 COLD1_29_D11.g1_A029 Root cold Pinus... 52 6e-005
gb|DR163147.1|DR163147 RTFE1_41_E12.b1_A029 Roots minus iro... 52 6e-005
gb|DR163235.1|DR163235 RTFE1_41_E12.g1_A029 Roots minus iro... 52 6e-005
gb|DR163481.1|DR163481 RTFE1_43_D12.b1_A029 Roots minus iro... 52 6e-005
gb|DR163657.1|DR163657 RTFE1_44_D12.b1_A029 Roots minus iro... 52 6e-005
gb|DR163745.1|DR163745 RTFE1_44_D12.g1_A029 Roots minus iro... 52 6e-005
gb|DR694543.1|DR694543 EST1084635 Normalized pine embryo li... 52 6e-005
gb|DR742067.1|DR742067 RTCU1_1_B09.g1_A029 Roots plus added... 52 6e-005
gb|DR745029.1|DR745029 RTCU1_26_C03.g1_A029 Roots plus adde... 52 6e-005
gb|DT639052.1|DT639052 EST1153983 Normalized pine embryo li... 52 6e-005
gb|BX251144.1|BX251144 BX251144 Pinus pinaster differenciat... 50 2e-004
gb|BX251561.1|BX251561 BX251561 Pinus pinaster differenciat... 50 2e-004
gb|BX251613.1|BX251613 BX251613 Pinus pinaster differenciat... 50 2e-004
gb|BX253271.1|BX253271 BX253271 Pinus pinaster differenciat... 50 2e-004
gb|BX254474.1|BX254474 BX254474 Pinus pinaster differenciat... 50 2e-004
gb|BE762031.1|BE762031 NXCI_076_B10_F NXCI (Nsf Xylem Compr... 50 2e-004
gb|CF386013.1|CF386013 RTDR1_7_F11.g1_A015 Loblolly pine ro... 50 2e-004
gb|CF391890.1|CF391890 RTDR3_10_G01.g1_A022 Loblolly pine r... 50 2e-004
gb|CF479851.1|CF479851 RTWW3_12_D07.g1_A022 Well-watered lo... 50 2e-004
gb|CF668487.1|CF668487 RTCNT1_36_F12.g1_A029 Root control P... 50 2e-004
gb|BX682844.1|BX682844 BX682844 Pinus pinaster differenciat... 50 2e-004
gb|CR393207.1|CR393207 CR393207 RN Pinus pinaster cDNA clon... 50 2e-004
gb|CR393417.1|CR393417 CR393417 RN Pinus pinaster cDNA clon... 50 2e-004
gb|CO166169.1|CO166169 FLD1_59_G05.g1_A029 Root flooded Pin... 50 2e-004
gb|CO169428.1|CO169428 NDL1_7_B04.b1_A029 Needles control P... 50 2e-004
gb|CO169500.1|CO169500 NDL1_7_B04.g1_A029 Needles control P... 50 2e-004
gb|CO200976.1|CO200976 RTCNT2_2_G03.g1_A029 Root control 2 ... 50 2e-004
gb|CO362158.1|CO362158 RTK1_1_E05.g1_A029 Roots minus potas... 50 2e-004
gb|CO362167.1|CO362167 RTK1_1_F05.g1_A029 Roots minus potas... 50 2e-004
gb|DR015281.1|DR015281 STRS1_2_C05.g1_A034 Shoot tip pitch ... 50 2e-004
gb|DR022663.1|DR022663 STRS1_52_D06.g1_A034 Shoot tip pitch... 50 2e-004
gb|DR023285.1|DR023285 STRS1_56_D02.g1_A034 Shoot tip pitch... 50 2e-004
gb|DR024833.1|DR024833 STRS1_67_F03.g1_A034 Shoot tip pitch... 50 2e-004
gb|DR051531.1|DR051531 RTBOR1_30_E09.g1_A029 Roots plus add... 50 2e-004
gb|DR070152.1|DR070152 RTDK1_11_D01.g1_A029 Roots, dark Pin... 50 2e-004
gb|DR070635.1|DR070635 RTDK1_14_D09.g1_A029 Roots, dark Pin... 50 2e-004
gb|DR080162.1|DR080162 RTFEPL1_20_E11.g1_A029 Roots plus ad... 50 2e-004
gb|DR093057.1|DR093057 STRR1_5_F06.g1_A033 Stem Response Re... 50 2e-004
gb|DR096273.1|DR096273 STRR1_26_H05.g1_A033 Stem Response R... 50 2e-004
gb|DR096352.1|DR096352 STRR1_27_A07.g1_A033 Stem Response R... 50 2e-004
gb|DR099166.1|DR099166 STRR1_53_C12.g1_A033 Stem Response R... 50 2e-004
gb|DR100480.1|DR100480 STRR1_64_A12.g1_A033 Stem Response R... 50 2e-004
gb|DR120128.1|DR120128 RTMG1_27_E05.g2_A029 Roots minus mag... 50 2e-004
gb|DR687528.1|DR687528 EST1077610 Normalized pine embryo li... 50 2e-004
gb|DR692513.1|DR692513 EST1082601 Normalized pine embryo li... 50 2e-004
gb|DR746394.1|DR746394 RTCU1_36_E04.g1_A029 Roots plus adde... 50 2e-004
gb|DT633920.1|DT633920 EST1148851 Normalized pine embryo li... 50 2e-004
gb|DT637181.1|DT637181 EST1152112 Normalized pine embryo li... 50 2e-004
gb|AA556812.1|AA556812 654 Loblolly pine C Pinus taeda cDNA... 48 9e-004
gb|AA556861.1|AA556861 703 Loblolly pine C Pinus taeda cDNA... 48 9e-004
gb|AW011524.1|AW011524 ST21H02 Pine TriplEx shoot tip libra... 48 9e-004
gb|BF049828.1|BF049828 NXCI_111_D09_F NXCI (Nsf Xylem Compr... 48 9e-004
gb|BF609532.1|BF609532 NXSI_043_G01_F NXSI (Nsf Xylem Side ... 48 9e-004
gb|BF778581.1|BF778581 NXSI_088_D02_F NXSI (Nsf Xylem Side ... 48 9e-004
gb|CX646780.1|CX646780 COLD1_11_B06.g1_A029 Root cold Pinus... 48 9e-004
gb|CX649475.1|CX649475 COLD1_35_B04.g1_A029 Root cold Pinus... 48 9e-004
gb|CX652556.1|CX652556 COLD1_59_H02.g1_A029 Root cold Pinus... 48 9e-004
gb|CX713463.1|CX713463 RTPQ1_9_C04.g1_A032 Roots treated wi... 48 9e-004
gb|DR011619.1|DR011619 HEAT1_6_G09.g1_A029 Root at 37 C for... 48 9e-004
gb|DR055148.1|DR055148 RTCA1_21_G09.g2_A029 Roots minus cal... 48 9e-004
gb|DR056610.1|DR056610 RTCA1_31_A02.g1_A029 Roots minus cal... 48 9e-004
gb|DR070179.1|DR070179 RTDK1_11_F07.g1_A029 Roots, dark Pin... 48 9e-004
gb|DR072178.1|DR072178 RTDK1_24_C09.g1_A029 Roots, dark Pin... 48 9e-004
gb|DR089298.1|DR089298 RTAL1_7_G03.g1_A029 Roots plus added... 48 9e-004
gb|DR090373.1|DR090373 RTAL1_14_D02.g1_A029 Roots plus adde... 48 9e-004
gb|DR090533.1|DR090533 RTAL1_15_E12.g1_A029 Roots plus adde... 48 9e-004
gb|DR092307.1|DR092307 RTAL1_28_G05.b1_A029 Roots plus adde... 48 9e-004
gb|DR098553.1|DR098553 STRR1_46_F12.b1_A033 Stem Response R... 48 9e-004
gb|DR100599.1|DR100599 STRR1_65_E02.g1_A033 Stem Response R... 48 9e-004
gb|DR102236.1|DR102236 STRR1_79_C04.g1_A033 Stem Response R... 48 9e-004
gb|DR113034.1|DR113034 RTS1_32_B12.g1_A029 Roots minus sulf... 48 9e-004
gb|DR163422.1|DR163422 RTFE1_42_G07.g1_A029 Roots minus iro... 48 9e-004
gb|DT636492.1|DT636492 EST1151423 Normalized pine embryo li... 48 9e-004
gb|CF386766.1|CF386766 RTDR1_16_C08.g1_A015 Loblolly pine r... 46 0.004
gb|CF400637.1|CF400637 RTWW1_6_B06.g1_A015 Well-watered lob... 46 0.004
gb|CF478581.1|CF478581 RTWW3_16_B04.b1_A022 Well-watered lo... 46 0.004
gb|DR055601.1|DR055601 RTCA1_24_E10.g2_A029 Roots minus cal... 46 0.004
gb|DR168662.1|DR168662 RTPHOS1_27_B09.b1_A029 Roots minus p... 46 0.004
gb|CF402042.1|CF402042 RTWW1_16_F09.g1_A015 Well-watered lo... 42 0.055
gb|BF609490.1|BF609490 NXSI_043_C03_F NXSI (Nsf Xylem Side ... 40 0.22
gb|DT632636.1|DT632636 EST1147567 Normalized pine embryo li... 40 0.22
>gb|CF476071.1|CF476071 RTWW2_16_D03.g1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_16_D03_A021 5', mRNA sequence
Length = 725
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 510 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 451
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 450 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 391
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 390 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 331
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 330 tgcccgttcacggtgaacc 312
>gb|CF479898.1|CF479898 RTWW3_12_H04.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_12_H04_A022 5', mRNA sequence
Length = 734
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 477 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 418
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 417 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 358
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 357 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 298
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 297 tgcccgttcacggtgaacc 279
>gb|CO197872.1|CO197872 GEO1_9_E12.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_9_E12_A029 5', mRNA sequence
Length = 812
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 760 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 701
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 700 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 641
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 640 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 581
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 580 tgcccgttcacggtgaacc 562
>gb|CX649869.1|CX649869 COLD1_42_B01.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_42_B01_A029 3', mRNA sequence
Length = 792
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 220 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 161
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 160 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 101
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 100 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 41
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 40 tgcccgttcacggtgaacc 22
>gb|CX649938.1|CX649938 COLD1_42_B01.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_42_B01_A029 5', mRNA sequence
Length = 862
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 743 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 684
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 683 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 624
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 623 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 564
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 563 tgcccgttcacggtgaacc 545
>gb|DR181356.1|DR181356 RTMNUT1_38_A01.g2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_38_A01_A029 5', mRNA sequence
Length = 765
Score = 109 bits (55), Expect = 3e-022
Identities = 163/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 719 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 660
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 659 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 600
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 599 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 540
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 539 tgcccgttcacggtgaacc 521
>gb|DR070227.1|DR070227 RTDK1_12_C03.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_12_C03_A029 3', mRNA sequence
Length = 725
Score = 101 bits (51), Expect = 7e-020
Identities = 102/119 (85%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||||| |||||| |||||||| |||| |||| ||||||||||
Sbjct: 176 ccgtcgctggtggtgaccttgaaggagaggctctgcccgttgaggtaactgttgctctgc 117
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatgga 641
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 116 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatgga 58
>gb|DR070312.1|DR070312 RTDK1_12_C03.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_12_C03_A029 5', mRNA sequence
Length = 710
Score = 101 bits (51), Expect = 7e-020
Identities = 162/199 (81%)
Strand = Plus / Minus
Query: 523 ccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgc 582
|||||||||| |||||| | |||||| |||||||| |||| |||| ||||||||||
Sbjct: 682 ccgtcgctggtggtgactttgaaggagaggctctgcccgttgaggtaactgttgctctgc 623
Query: 583 cagttctggccccagttgcgggacatgggctgccacccggtgctggagcccttgatggac 642
|| ||||||||||||||||||||||| || |||||||| || || |||||||| |||||
Sbjct: 622 caattctggccccagttgcgggacattggttgccaccctgtcctagagccctttatggaa 563
Query: 643 acggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttgaagtaggag 702
|| | || |||||||| || ||| | ||||| || | || ||||| |||||||| |||
Sbjct: 562 accgcgtggacgtcccctgctccgccaacgttagtgatgaggaccagattgaagtacgag 503
Query: 703 tggccgttgatggtgaacc 721
|| ||||| | ||||||||
Sbjct: 502 tgcccgttcacggtgaacc 484
>gb|U64890.1|PTU64890 Pinus taeda expansin mRNA, partial cds
Length = 923
Score = 91.7 bits (46), Expect = 7e-017
Identities = 85/98 (86%)
Strand = Plus / Minus
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
||||| ||||||| ||||||||||| || |||||||| |||| |||| ||| |||||
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530
Score = 52.0 bits (26), Expect = 6e-005
Identities = 59/70 (84%)
Strand = Plus / Minus
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
|||| ||||||||||| || |||| |||| |||| || ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttgggaagagcgttgttcggcgggcagaagt 255
Query: 893 tggtggccgt 902
|||| |||||
Sbjct: 254 tggtagccgt 245
>gb|U64891.1|PTU64891 Pinus taeda expansin mRNA, partial cds
Length = 919
Score = 91.7 bits (46), Expect = 7e-017
Identities = 85/98 (86%)
Strand = Plus / Minus
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
||||| ||||||| ||||||||||| || |||||||| |||| |||| ||| |||||
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
|||| ||||||||||| || |||| |||| ||||||| ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggcgggcagaagt 255
Query: 893 tggtggccgt 902
|||| |||||
Sbjct: 254 tggtagccgt 245
>gb|U64893.1|PTU64893 Pinus taeda expansin mRNA, partial cds
Length = 891
Score = 91.7 bits (46), Expect = 7e-017
Identities = 85/98 (86%)
Strand = Plus / Minus
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
||||| ||||||| ||||||||||| || |||||||| |||| |||| ||||||||
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtaggagttgctt 568
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530
Score = 65.9 bits (33), Expect = 4e-009
Identities = 174/221 (78%)
Strand = Plus / Minus
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
||||||||||||||||| |||||||| || | |||||| | || || |||||| ||| |
Sbjct: 465 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattccacccttcctcaag 406
Query: 742 cacggcaccctcctgtaggcgacgggcacgatgccggcgcggtactgcgcgatctggagg 801
|| || ||||| ||||| || ||| ||||| || | | ||||| |||||||| ||
Sbjct: 405 caggggacccttgtgtagaggatggggacgatcccacccctgtacttcgcgatcttcaga 346
Query: 802 aaggccggctgggccatgtcgaagtgcgggcgcggcgggttgcaccagccgccgtcgtcg 861
|| || |||| ||||| ||||| ||| | |||| ||||||||||| || |||| ||||
Sbjct: 345 aaagcgggctccgccatatcgaaatgctgcagcggtgggttgcaccatccaccgttgtcg 286
Query: 862 ctggggaggccgtagttgggcgggcagaagttggtggccgt 902
||||||| ||| ||| ||||||||||||||||| |||||
Sbjct: 285 ttggggagagcgttgtttggcgggcagaagttggtagccgt 245
>gb|AF085330.1|AF085330 Pinus taeda expansin mRNA, complete cds
Length = 998
Score = 91.7 bits (46), Expect = 7e-017
Identities = 85/98 (86%)
Strand = Plus / Minus
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
||||| ||||||| ||||||||||| || |||||||| |||| |||| ||| |||||
Sbjct: 778 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 719
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
||||||||||| ||||||||||| ||||||||||||||
Sbjct: 718 tgccagttctgtccccagttgcgtgacatgggctgcca 681
Score = 52.0 bits (26), Expect = 6e-005
Identities = 59/70 (84%)
Strand = Plus / Minus
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
|||| ||||||||||| || |||| |||| ||||||| ||| ||| || ||||||||||
Sbjct: 465 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggtgggcagaagt 406
Query: 893 tggtggccgt 902
|||| |||||
Sbjct: 405 tggtagccgt 396
>gb|U64892.1|PTU64892 Pinus taeda expansin mRNA, partial cds
Length = 923
Score = 91.7 bits (46), Expect = 7e-017
Identities = 85/98 (86%)
Strand = Plus / Minus
Query: 520 cggccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctc 579
||||| ||||||| ||||||||||| || |||||||| |||| |||| ||| |||||
Sbjct: 627 cggccatcgctggttgtgacctggaacgaaaggctctgtccgttgaggtacgaattgctt 568
Query: 580 tgccagttctggccccagttgcgggacatgggctgcca 617
||||||||||| ||||||||||| ||||||||||||||
Sbjct: 567 tgccagttctgtccccagttgcgtgacatgggctgcca 530
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 833 gcggcgggttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagt 892
|||| ||||||||||| || |||| |||| ||||||| ||| ||| |||||||||||||
Sbjct: 314 gcggtgggttgcaccatccaccgttgtcgttggggagagcgttgtttggcgggcagaagt 255
Query: 893 tggtggccgt 902
|||| |||||
Sbjct: 254 tggtagccgt 245
>gb|DR097316.1|DR097316 STRR1_33_H05.g3_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_33_H05_A033 5', mRNA sequence
Length = 794
Score = 87.7 bits (44), Expect = 1e-015
Identities = 83/96 (86%)
Strand = Plus / Plus
Query: 522 gccgtcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctg 581
||||||||||| |||||| |||||||| |||||||| |||| ||| |||||||| ||
Sbjct: 225 gccgtcgctggtggtgacttggaaggataggctctgtccgttcaggtaagagttgctttg 284
Query: 582 ccagttctggccccagttgcgggacatgggctgcca 617
||||||||| ||||||||||| ||||||| ||||||
Sbjct: 285 ccagttctgtccccagttgcgtgacatggcctgcca 320
Score = 46.1 bits (23), Expect = 0.004
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggc 899
|||||||| ||||||| |||| |||| || | | ||| ||||||||||||||||||||
Sbjct: 544 ttgcaccacccgccgttgtcgttgggaagagcattgtttggcgggcagaagttggtggc 602
>gb|DR011201.1|DR011201 HEAT1_4_E06.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_4_E06_A029 3', mRNA sequence
Length = 752
Score = 77.8 bits (39), Expect = 1e-012
Identities = 81/95 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || ||||| |||||||||
Sbjct: 339 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 280
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| |||||||||||||| |||||
Sbjct: 279 tgtccccagttgcgtgacatgggctgccaaccggt 245
Score = 42.1 bits (21), Expect = 0.055
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 688 aggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacgcacggc 747
||||||||||| ||||||||| ||| ||||| | || ||||||||| ||| ||||||
Sbjct: 180 aggttgaagtatgagtggccggcgatagtgaagcgaattccgcccttcctcaagcacggg 121
Query: 748 accct 752
|||||
Sbjct: 120 accct 116
>gb|DR047687.1|DR047687 RTBOR1_2_F07.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_2_F07_A029 5', mRNA sequence
Length = 689
Score = 77.8 bits (39), Expect = 1e-012
Identities = 81/95 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || ||||| |||||||||
Sbjct: 218 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 159
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| |||||||||||||| |||||
Sbjct: 158 tgtccccagttgcgtgacatgggctgccaaccggt 124
>gb|DR180723.1|DR180723 RTMNUT1_34_A06.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_34_A06_A029 5', mRNA sequence
Length = 773
Score = 77.8 bits (39), Expect = 1e-012
Identities = 81/95 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || ||||| |||||||||
Sbjct: 685 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 626
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| |||||||||||||| |||||
Sbjct: 625 tgtccccagttgcgtgacatgggctgccaaccggt 591
>gb|CF477384.1|CF477384 RTWW3_7_A01.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_7_A01_A022 5', mRNA sequence
Length = 715
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 690 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 631
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 630 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 571
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 570 ttgaagtaggagtgcccattgatcgtgaa 542
>gb|CO367410.1|CO367410 RTK1_34_D03.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_34_D03_A029 3', mRNA sequence
Length = 851
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 504 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 445
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 444 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 385
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 384 ttgaagtaggagtgcccattgatcgtgaa 356
>gb|CO367487.1|CO367487 RTK1_34_D03.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_34_D03_A029 5', mRNA sequence
Length = 788
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 695 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 636
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 635 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 576
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 575 ttgaagtaggagtgcccattgatcgtgaa 547
>gb|CO369598.1|CO369598 RTK1_48_F01.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_48_F01_A029 3', mRNA sequence
Length = 820
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | | ||| || ||| ||||
Sbjct: 329 gagttgctctgccaattctgtccccagttgcgggacattgcttcccaaccagtgttggaa 388
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||||||||| ||||| | |||||||| | |||||||
Sbjct: 389 cctttgatggaaacagcctccacgtcccctgcgcctcctacgttggtaatgagcaccaaa 448
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
||||| |||||||| || ||||| |||||
Sbjct: 449 ttgaaataggagtgcccattgattgtgaa 477
>gb|CO369680.1|CO369680 RTK1_48_F01.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_48_F01_A029 5', mRNA sequence
Length = 697
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | | ||| || ||| ||||
Sbjct: 543 gagttgctctgccaattctgtccccagttgcgggacattgcttcccaaccagtgttggaa 602
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||||||||| ||||| | |||||||| | |||||||
Sbjct: 603 cctttgatggaaacagcctccacgtcccctgcgcctcctacgttggtaatgagcaccaaa 662
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
||||| |||||||| || ||||| |||||
Sbjct: 663 ttgaaataggagtgcccattgattgtgaa 691
>gb|CX648930.1|CX648930 COLD1_31_H02.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_31_H02_A029 5', mRNA sequence
Length = 857
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 719 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 660
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 659 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 600
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 599 ttgaagtaggagtgcccattgatcgtgaa 571
>gb|DR050231.1|DR050231 RTBOR1_22_D04.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_22_D04_A029 3', mRNA sequence
Length = 692
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 227 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 168
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 167 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 108
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 107 ttgaagtaggagtgcccattgatcgtgaa 79
>gb|DR050310.1|DR050310 RTBOR1_22_D04.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_22_D04_A029 5', mRNA sequence
Length = 806
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 717 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 658
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 657 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 598
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 597 ttgaagtaggagtgcccattgatcgtgaa 569
>gb|DR051834.1|DR051834 RTBOR1_32_E10.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_32_E10_A029 5', mRNA sequence
Length = 796
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 736 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 677
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 676 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 617
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 616 ttgaagtaggagtgcccattgatcgtgaa 588
>gb|DR093671.1|DR093671 STRR1_9_E07.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_9_E07_A033 5', mRNA sequence
Length = 789
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 705 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 646
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 645 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 586
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 585 ttgaagtaggagtgcccattgatcgtgaa 557
>gb|DR165660.1|DR165660 RTPHOS1_6_B10.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_6_B10_A029 5', mRNA sequence
Length = 779
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 359 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 418
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 419 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 478
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 479 ttgaagtaggagtgcccattgatcgtgaa 507
>gb|DR168497.1|DR168497 RTPHOS1_25_G11.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_25_G11_A029 5', mRNA sequence
Length = 702
Score = 73.8 bits (37), Expect = 2e-011
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 694 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 635
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | |||||||
Sbjct: 634 cctttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaa 575
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 574 ttgaagtaggagtgcccattgatcgtgaa 546
>gb|DR683982.1|DR683982 EST1074058 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAN59 3' end, mRNA sequence
Length = 876
Score = 73.8 bits (37), Expect = 2e-011
Identities = 76/89 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | || || ||||| |||||||||
Sbjct: 495 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 436
Query: 589 tggccccagttgcgggacatgggctgcca 617
|| ||||||||||| ||||| ||||||||
Sbjct: 435 tgtccccagttgcgtgacatcggctgcca 407
Score = 42.1 bits (21), Expect = 0.055
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
|||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| ||
Sbjct: 183 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 124
Query: 901 gtgac 905
|||||
Sbjct: 123 gtgac 119
>gb|DT631935.1|DT631935 EST1146866 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFE52 3' end, mRNA sequence
Length = 858
Score = 73.8 bits (37), Expect = 2e-011
Identities = 76/89 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | || || ||||| |||||||||
Sbjct: 503 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 444
Query: 589 tggccccagttgcgggacatgggctgcca 617
|| ||||||||||| ||||| ||||||||
Sbjct: 443 tgtccccagttgcgtgacatcggctgcca 415
Score = 42.1 bits (21), Expect = 0.055
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
|||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| ||
Sbjct: 191 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 132
Query: 901 gtgac 905
|||||
Sbjct: 131 gtgac 127
>gb|DT632413.1|DT632413 EST1147344 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFJ73 3' end, mRNA sequence
Length = 826
Score = 73.8 bits (37), Expect = 2e-011
Identities = 76/89 (85%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | || || ||||| |||||||||
Sbjct: 763 ctggtggtgaccttgaaggacaggctctgcccgttcaagaaggaattgctttgccagttc 704
Query: 589 tggccccagttgcgggacatgggctgcca 617
|| ||||||||||| ||||| ||||||||
Sbjct: 703 tgtccccagttgcgtgacatcggctgcca 675
Score = 42.1 bits (21), Expect = 0.055
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 841 ttgcaccagccgccgtcgtcgctggggaggccgtagttgggcgggcagaagttggtggcc 900
|||||||| || |||| || | |||| ||| ||| |||||| |||||||||||||| ||
Sbjct: 451 ttgcaccatccaccgttgttgttgggaagggcgttgttgggtgggcagaagttggtcgct 392
Query: 901 gtgac 905
|||||
Sbjct: 391 gtgac 387
>gb|DR010784.1|DR010784 HEAT1_1_F12.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_1_F12_A029 3', mRNA sequence
Length = 680
Score = 69.9 bits (35), Expect = 2e-010
Identities = 80/95 (84%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || ||||| |||||||||
Sbjct: 274 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 215
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| ||||| |||||||| |||||
Sbjct: 214 tgtccccagttgcgtgacataggctgccaaccggt 180
>gb|DR010861.1|DR010861 HEAT1_1_F12.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_1_F12_A029 5', mRNA sequence
Length = 733
Score = 69.9 bits (35), Expect = 2e-010
Identities = 80/95 (84%)
Strand = Plus / Minus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || ||||| |||||||||
Sbjct: 675 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattgctttgccagttc 616
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| ||||| |||||||| |||||
Sbjct: 615 tgtccccagttgcgtgacataggctgccaaccggt 581
>gb|DR120161.1|DR120161 RTMG1_27_H07.g2_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_27_H07_A029 5', mRNA sequence
Length = 693
Score = 67.9 bits (34), Expect = 1e-009
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgccacccggt 623
||||| ||||||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 663 ttgctttgccagttctgtccccagttgcgtgacatgggctgccaaccggt 614
>gb|DR120696.1|DR120696 RTMG1_31_G12.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_31_G12_A029 3', mRNA sequence
Length = 865
Score = 67.9 bits (34), Expect = 1e-009
Identities = 118/146 (80%)
Strand = Plus / Plus
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggagccc 633
||||||||||| ||||| ||||||||||||||||| | ||||| || ||| |||| ||
Sbjct: 144 ttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaacct 203
Query: 634 ttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccaggttg 693
|||||||| || | || ||| || || ||||| | |||||||| | ||||||| |||
Sbjct: 204 ttgatggaaactgcctccacatcgcctgcgcctcctacgttggtaatgagcaccaaattg 263
Query: 694 aagtaggagtggccgttgatggtgaa 719
||||||||||| || ||||| |||||
Sbjct: 264 aagtaggagtgcccattgatcgtgaa 289
>gb|CV144435.1|CV144435 EST855644 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPID557 5' end, mRNA sequence
Length = 769
Score = 65.9 bits (33), Expect = 4e-009
Identities = 120/149 (80%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 678 gagttgctctgccaattctgtccccagttgcgggacattgcttgccaaccagtgttggat 619
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | || ||||
Sbjct: 618 cctttgatggaaaccgcctccacatcgcctgcgcctcctacgttggtaatgagtaccaaa 559
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 558 ttgaagtaggagtgcccattgatcgtgaa 530
>gb|DT624714.1|DT624714 EST1159049 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMAI31 5' end, mRNA sequence
Length = 844
Score = 65.9 bits (33), Expect = 4e-009
Identities = 120/149 (80%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 678 gagttgctctgccaattctgtccccagttgcgggacattgcttgccaaccagtgttggat 619
Query: 631 cccttgatggacacggactgcacgtccccggcgccggccacgttggtcaccagcaccagg 690
|| |||||||| || | || ||| || || ||||| | |||||||| | || ||||
Sbjct: 618 cctttgatggaaaccgcctccacatcgcctgcgcctcctacgttggtaatgagtaccaaa 559
Query: 691 ttgaagtaggagtggccgttgatggtgaa 719
|||||||||||||| || ||||| |||||
Sbjct: 558 ttgaagtaggagtgcccattgatcgtgaa 530
>gb|CF399941.1|CF399941 RTWW1_2_C11.b1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_2_C11_A015 3', mRNA sequence
Length = 668
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 274 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 231
Score = 46.1 bits (23), Expect = 0.004
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
||||||||||||||||| |||||||| || | |||||| | || || |||||| |||||
Sbjct: 166 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 107
Query: 742 cacggcaccct 752
|| || |||||
Sbjct: 106 caggggaccct 96
>gb|CX650634.1|CX650634 COLD1_47_B12.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_47_B12_A029 3', mRNA sequence
Length = 711
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 220 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 177
Score = 52.0 bits (26), Expect = 6e-005
Identities = 65/78 (83%)
Strand = Plus / Minus
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
||||||||||||||||| |||||||| || | |||||| | || || |||||| |||||
Sbjct: 112 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 53
Query: 742 cacggcaccctcctgtag 759
|| || ||||| ||||||
Sbjct: 52 caggggacccttctgtag 35
>gb|CX650703.1|CX650703 COLD1_47_B12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_47_B12_A029 5', mRNA sequence
Length = 629
Score = 63.9 bits (32), Expect = 2e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 574 ttgctctgccagttctggccccagttgcgggacatgggctgcca 617
||||| ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 502 ttgctttgccagttctgtccccagttgcgtgacatgggctgcca 459
Score = 58.0 bits (29), Expect = 9e-007
Identities = 173/221 (78%)
Strand = Plus / Minus
Query: 682 agcaccaggttgaagtaggagtggccgttgatggtgaacctgatcccgcccttcttcacg 741
||||||||||||||||| |||||||| || | |||||| | || || |||||| |||||
Sbjct: 394 agcaccaggttgaagtatgagtggccattcacggtgaaacgaattcctcccttcctcacg 335
Query: 742 cacggcaccctcctgtaggcgacgggcacgatgccggcgcggtactgcgcgatctggagg 801
|| || ||||| |||||| || || ||||| || | ||||| ||||||||| |
Sbjct: 334 caggggacccttctgtagaggatagggacgatcccccccttgtacttcgcgatctgctga 275
Query: 802 aaggccggctgggccatgtcgaagtgcgggcgcggcgggttgcaccagccgccgtcgtcg 861
|| || |||| ||||| ||||| ||| | |||| ||||||||||| || |||| ||||
Sbjct: 274 aaagcgggctccgccatatcgaaatgctgcagcggtgggttgcaccatccaccgttgtcg 215
Query: 862 ctggggaggccgtagttgggcgggcagaagttggtggccgt 902
||||||| ||| ||| |||||||||||||| || |||||
Sbjct: 214 ttggggagagcgttgtttggcgggcagaagttagtagccgt 174
>gb|DR019211.1|DR019211 STRS1_28_B06.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_28_B06_A034 5', mRNA sequence
Length = 869
Score = 63.9 bits (32), Expect = 2e-008
Identities = 77/92 (83%)
Strand = Plus / Minus
Query: 526 tcgctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccag 585
||||||| |||||||| |||||| ||||||||||| | |||| |||||||| |||||
Sbjct: 731 tcgctggtggtgaccttgaaggagaggctctggccattgaggtaggagttgctttgccaa 672
Query: 586 ttctggccccagttgcgggacatgggctgcca 617
|| || ||||||||||| ||||| || |||||
Sbjct: 671 ttttgtccccagttgcgtgacattggttgcca 640
>gb|CF471900.1|CF471900 RTDS1_7_A08.b1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_7_A08_A015 3', mRNA sequence
Length = 661
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| ||||
Sbjct: 250 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 191
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 190 cctttgatgga 180
>gb|CF471926.1|CF471926 RTDS1_7_A08.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_7_A08_A015 5', mRNA sequence
Length = 751
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| ||||
Sbjct: 595 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 536
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 535 cctttgatgga 525
>gb|CF668214.1|CF668214 RTCNT1_35_D04.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_D04_A029 3', mRNA sequence
Length = 592
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| ||||
Sbjct: 243 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 184
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 183 cctttgatgga 173
>gb|CF668294.1|CF668294 RTCNT1_35_D04.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_D04_A029 5', mRNA sequence
Length = 751
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| ||||
Sbjct: 548 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 489
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 488 cctttgatgga 478
>gb|DR051762.1|DR051762 RTBOR1_32_E10.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_32_E10_A029 3', mRNA sequence
Length = 574
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||||||||| | ||||| || ||| ||||
Sbjct: 124 gagttgctctgccaattctgtccccagttgcgggacattgtttgccaaccagtgttggaa 65
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 64 cctttgatgga 54
>gb|DR096360.1|DR096360 STRR1_27_B05.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_27_B05_A033 5', mRNA sequence
Length = 780
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 571 gagttgctctgccagttctggccccagttgcgggacatgggctgccacccggtgctggag 630
|||||||||||||| ||||| ||||||||||| ||||| || ||||| || ||| ||||
Sbjct: 484 gagttgctctgccaattctgtccccagttgcgtgacattggttgccaaccagtgttggaa 425
Query: 631 cccttgatgga 641
|| ||||||||
Sbjct: 424 cctttgatgga 414
>gb|DR119250.1|DR119250 RTMG1_22_C11.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_22_C11_A029 3', mRNA sequence
Length = 773
Score = 61.9 bits (31), Expect = 6e-008
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || || || |||||||||
Sbjct: 406 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattactttgccagttc 465
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| ||||| |||||||| |||||
Sbjct: 466 tgtccccagttgcgtgacataggctgccaaccggt 500
>gb|DR119331.1|DR119331 RTMG1_22_C11.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_22_C11_A029 5', mRNA sequence
Length = 753
Score = 61.9 bits (31), Expect = 6e-008
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 529 ctggcggtgacctggaaggacaggctctggccgtcgaggagcgagttgctctgccagttc 588
|||| |||||||| ||||||||||||||| |||| | | || || || |||||||||
Sbjct: 387 ctggtggtgaccttgaaggacaggctctgcccgttcaacaaggaattactttgccagttc 446
Query: 589 tggccccagttgcgggacatgggctgccacccggt 623
|| ||||||||||| ||||| |||||||| |||||
Sbjct: 447 tgtccccagttgcgtgacataggctgccaaccggt 481
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 135,428
Number of Sequences: 355925
Number of extensions: 135428
Number of successful extensions: 36587
Number of sequences better than 0.5: 164
Number of HSP's better than 0.5 without gapping: 155
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 36021
Number of HSP's gapped (non-prelim): 514
length of query: 1271
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1252
effective length of database: 210,514,662
effective search space: 263564356824
effective search space used: 263564356824
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)