BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.006E19F020311.3.1
(789 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC146548.9| Medicago truncatula clone mth2-2p3, complete... 42 0.070
gb|AC171394.2| Medicago truncatula clone mth2-38p7, WORKING... 42 0.070
gb|AC146329.18| Medicago truncatula clone mth2-5i21, comple... 42 0.070
gb|AC134967.20| Medicago truncatula clone mth2-26b8, comple... 40 0.28
gb|AC169788.4| Medicago truncatula clone mth2-28c18, comple... 40 0.28
>gb|AC146548.9| Medicago truncatula clone mth2-2p3, complete sequence
Length = 129327
Score = 42.1 bits (21), Expect = 0.070
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
||||| ||||||||||| || || |||| || |||||||||||||| |||||
Sbjct: 118427 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 118375
Score = 42.1 bits (21), Expect = 0.070
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
||||| ||||||||||| || || |||| || |||||||||||||| |||||
Sbjct: 100637 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 100585
>gb|AC171394.2| Medicago truncatula clone mth2-38p7, WORKING DRAFT SEQUENCE, 2
unordered pieces
Length = 91342
Score = 42.1 bits (21), Expect = 0.070
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
||||| ||||||||||| || || |||| || |||||||||||||| |||||
Sbjct: 4301 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 4249
>gb|AC146329.18| Medicago truncatula clone mth2-5i21, complete sequence
Length = 129327
Score = 42.1 bits (21), Expect = 0.070
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
||||| ||||||||||| || || |||| || |||||||||||||| |||||
Sbjct: 118427 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 118375
Score = 42.1 bits (21), Expect = 0.070
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 494 ctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggtct 546
||||| ||||||||||| || || |||| || |||||||||||||| |||||
Sbjct: 100637 ctggtttatgagaagcaacaaaaattaagaatcatgatgaaaatgcatggtct 100585
>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
Length = 133030
Score = 40.1 bits (20), Expect = 0.28
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 128 attatcaaccatgaattttt 147
||||||||||||||||||||
Sbjct: 44275 attatcaaccatgaattttt 44256
>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
Length = 122876
Score = 40.1 bits (20), Expect = 0.28
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 128 attatcaaccatgaattttt 147
||||||||||||||||||||
Sbjct: 77429 attatcaaccatgaattttt 77448
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 278,808
Number of Sequences: 392609
Number of extensions: 278808
Number of successful extensions: 20575
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20526
Number of HSP's gapped (non-prelim): 49
length of query: 789
length of database: 441,732,993
effective HSP length: 20
effective length of query: 769
effective length of database: 433,880,813
effective search space: 333654345197
effective search space used: 333654345197
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)