BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAH4a02.xg.2.1
(526 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC161401.2| Medicago truncatula chromosome 7 clone mte1-... 46 0.003
gb|AC141107.5| Medicago truncatula clone mth2-34a12, comple... 40 0.18
>gb|AC161401.2| Medicago truncatula chromosome 7 clone mte1-59b16, *** SEQUENCING IN
PROGRESS ***, 2 ordered pieces
Length = 95675
Score = 46.1 bits (23), Expect = 0.003
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 25 gctgaagctgcatttctcattgg 47
|||||||||||||||||||||||
Sbjct: 46859 gctgaagctgcatttctcattgg 46881
Score = 46.1 bits (23), Expect = 0.003
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 25 gctgaagctgcatttctcattgg 47
|||||||||||||||||||||||
Sbjct: 7571 gctgaagctgcatttctcattgg 7593
Score = 46.1 bits (23), Expect = 0.003
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 25 gctgaagctgcatttctcattgg 47
|||||||||||||||||||||||
Sbjct: 1074 gctgaagctgcatttctcattgg 1096
>gb|AC141107.5| Medicago truncatula clone mth2-34a12, complete sequence
Length = 142659
Score = 40.1 bits (20), Expect = 0.18
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 25 gctgaagctgcatttctcattggattagaaag 56
|||||||||| ||| || ||||||||||||||
Sbjct: 65180 gctgaagctggattccttattggattagaaag 65211
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 133,938
Number of Sequences: 392609
Number of extensions: 133938
Number of successful extensions: 8761
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8749
Number of HSP's gapped (non-prelim): 12
length of query: 526
length of database: 441,732,993
effective HSP length: 19
effective length of query: 507
effective length of database: 434,273,422
effective search space: 220176624954
effective search space used: 220176624954
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)