BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2751069.2.1
(940 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW686191.1|AW686191 NF035A10NR1F1000 Nodulated root Medi... 52 9e-005
gb|CG950614.1|CG950614 MBEDF56TRC mth2 Medicago truncatula ... 48 0.001
gb|AC138171.17| Medicago truncatula clone mth2-7f10, comple... 48 0.001
emb|CR327997.1| mte1-56J10FM1 BAC end, cultivar Jemalong A1... 42 0.083
emb|CR314085.1| mte1-37F7RM1 BAC end, cultivar Jemalong A17... 42 0.083
emb|CR970114.1| mth4-23A5RM1 BAC end, cultivar Jemalong A17... 42 0.083
emb|CR486312.1| mth2-155N1FM2 BAC end, cultivar Jemalong A1... 40 0.33
emb|CR498427.1| mth2-174F14RM1 BAC end, cultivar Jemalong A... 40 0.33
gb|CX518869.1|CX518869 s13dNF38B10VI089_438958 Virus-Infect... 40 0.33
gb|AC153000.5| Medicago truncatula clone mth2-94c2, complet... 40 0.33
gb|AC151674.9| Medicago truncatula clone mth2-28i16, WORKIN... 40 0.33
>gb|AW686191.1|AW686191 NF035A10NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF035A10NR 5', mRNA sequence
Length = 661
Score = 52.0 bits (26), Expect = 9e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 401 taatcagcccattcagatctatgctccctcagaaatcg 438
|||||||||||||| |||| ||||||||||| ||||||
Sbjct: 513 taatcagcccattctgatcgatgctccctcaaaaatcg 476
>gb|CG950614.1|CG950614 MBEDF56TRC mth2 Medicago truncatula genomic clone 31I16, DNA
sequence
Length = 840
Score = 48.1 bits (24), Expect = 0.001
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 674 agaactgcaggttgccttcccaaggcatacactacttctccacttgtttcttgagc 729
|||||||||||||||| |||| | |||||| || || |||||||||||||||||
Sbjct: 120 agaactgcaggttgccgacccatgctatacaccacgtcaccacttgtttcttgagc 65
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 599 acagaccaaccatcatcattgaa 621
|||||||||||||||||||||||
Sbjct: 302 acagaccaaccatcatcattgaa 280
>gb|AC138171.17| Medicago truncatula clone mth2-7f10, complete sequence
Length = 104336
Score = 48.1 bits (24), Expect = 0.001
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 674 agaactgcaggttgccttcccaaggcatacactacttctccacttgtttcttgagc 729
|||||||||||||||| |||| | |||||| || || |||||||||||||||||
Sbjct: 80866 agaactgcaggttgccgacccatgctatacaccacgtcaccacttgtttcttgagc 80811
>emb|CR327997.1| mte1-56J10FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 773
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 602 gaccaaccatcatcattgaaa 622
|||||||||||||||||||||
Sbjct: 121 gaccaaccatcatcattgaaa 141
>emb|CR314085.1| mte1-37F7RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 510
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 602 gaccaaccatcatcattgaaa 622
|||||||||||||||||||||
Sbjct: 107 gaccaaccatcatcattgaaa 127
>emb|CR970114.1| mth4-23A5RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 515
Score = 42.1 bits (21), Expect = 0.083
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 602 gaccaaccatcatcattgaaa 622
|||||||||||||||||||||
Sbjct: 457 gaccaaccatcatcattgaaa 477
>emb|CR486312.1| mth2-155N1FM2 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 718
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 536 ttcctaattttcttggttga 555
||||||||||||||||||||
Sbjct: 448 ttcctaattttcttggttga 467
>emb|CR498427.1| mth2-174F14RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 630
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 536 ttcctaattttcttggttga 555
||||||||||||||||||||
Sbjct: 449 ttcctaattttcttggttga 468
>gb|CX518869.1|CX518869 s13dNF38B10VI089_438958 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 582
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 53 ttaactgttttcatatcaag 72
||||||||||||||||||||
Sbjct: 496 ttaactgttttcatatcaag 515
>gb|AC153000.5| Medicago truncatula clone mth2-94c2, complete sequence
Length = 97390
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 125 tcatcaattggtgcaaacacaagc 148
|||||||| |||||||||||||||
Sbjct: 8549 tcatcaataggtgcaaacacaagc 8572
>gb|AC151674.9| Medicago truncatula clone mth2-28i16, WORKING DRAFT SEQUENCE
Length = 128180
Score = 40.1 bits (20), Expect = 0.33
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 125 tcatcaattggtgcaaacacaagc 148
|||||||| |||||||||||||||
Sbjct: 14303 tcatcaataggtgcaaacacaagc 14280
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 242,136
Number of Sequences: 392609
Number of extensions: 242136
Number of successful extensions: 18642
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18607
Number of HSP's gapped (non-prelim): 35
length of query: 940
length of database: 441,732,993
effective HSP length: 20
effective length of query: 920
effective length of database: 433,880,813
effective search space: 399170347960
effective search space used: 399170347960
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)