BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521825.2.1
(2812 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC170988.4| Medicago truncatula chromosome 7 clone mth2-... 46 0.016
>gb|AC170988.4| Medicago truncatula chromosome 7 clone mth2-53m12, *** SEQUENCING IN
PROGRESS ***
Length = 122501
Score = 46.1 bits (23), Expect = 0.016
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 1535 tacagcattgatgtaactccatcaaatcggaagccatcaaacatgaattcatcca 1589
|||| ||||||||| || ||||||||||| || ||||||||| | |||||||||
Sbjct: 103586 tacatcattgatgtgacaccatcaaatcgaaacccatcaaacttatattcatcca 103532
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 671,022
Number of Sequences: 392609
Number of extensions: 671022
Number of successful extensions: 47543
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47521
Number of HSP's gapped (non-prelim): 22
length of query: 2812
length of database: 441,732,993
effective HSP length: 21
effective length of query: 2791
effective length of database: 433,488,204
effective search space: 1209865577364
effective search space used: 1209865577364
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)