BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419405.2.3
(1600 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CG924305.1|CG924305 MBEGO84TR mth2 Medicago truncatula g... 44 0.036
gb|BG457173.1|BG457173 NF100F02PL1F1025 Phosphate starved l... 44 0.036
gb|DW016987.1|DW016987 EST1225948 MTY Medicago truncatula c... 44 0.036
gb|AC147715.10| Medicago truncatula clone mth2-76b9, WORKIN... 44 0.036
gb|AJ389008.1|AJ389008 AJ389008 Medicago truncatula R108 Me... 42 0.14
gb|CF069940.1|CF069940 EST670661 MTUS Medicago truncatula c... 42 0.14
gb|CX520741.1|CX520741 s13dNF62E01VI003_449268 Virus-Infect... 42 0.14
gb|AC157503.3| Medicago truncatula chromosome 2 BAC clone m... 42 0.14
>gb|CG924305.1|CG924305 MBEGO84TR mth2 Medicago truncatula genomic clone 51N23, DNA
sequence
Length = 846
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 202 tgaagatgatgatgatgataaa 223
||||||||||||||||||||||
Sbjct: 373 tgaagatgatgatgatgataaa 352
>gb|BG457173.1|BG457173 NF100F02PL1F1025 Phosphate starved leaf Medicago truncatula cDNA
clone NF100F02PL 5', mRNA sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 199 gaatgaagatgatgatgatgat 220
||||||||||||||||||||||
Sbjct: 50 gaatgaagatgatgatgatgat 29
>gb|DW016987.1|DW016987 EST1225948 MTY Medicago truncatula cDNA clone MTYAO09, mRNA
sequence
Length = 689
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 199 gaatgaagatgatgatgatgat 220
||||||||||||||||||||||
Sbjct: 148 gaatgaagatgatgatgatgat 127
>gb|AC147715.10| Medicago truncatula clone mth2-76b9, WORKING DRAFT SEQUENCE, 24
unordered pieces
Length = 81122
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 202 tgaagatgatgatgatgataaa 223
||||||||||||||||||||||
Sbjct: 52953 tgaagatgatgatgatgataaa 52932
>gb|AJ389008.1|AJ389008 AJ389008 Medicago truncatula R108 Medicago truncatula cDNA clone
MtNo385, mRNA sequence
Length = 345
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 203 gaagatgatgatgatgataaa 223
|||||||||||||||||||||
Sbjct: 149 gaagatgatgatgatgataaa 169
>gb|CF069940.1|CF069940 EST670661 MTUS Medicago truncatula cDNA clone MTUS-26B2, mRNA
sequence
Length = 575
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 200 aatgaagatgatgatgatgat 220
|||||||||||||||||||||
Sbjct: 97 aatgaagatgatgatgatgat 117
>gb|CX520741.1|CX520741 s13dNF62E01VI003_449268 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 452
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 200 aatgaagatgatgatgatgat 220
|||||||||||||||||||||
Sbjct: 421 aatgaagatgatgatgatgat 441
>gb|AC157503.3| Medicago truncatula chromosome 2 BAC clone mte1-58k20, complete
sequence
Length = 115769
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 200 aatgaagatgatgatgatgat 220
|||||||||||||||||||||
Sbjct: 84793 aatgaagatgatgatgatgat 84773
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 232,892
Number of Sequences: 392609
Number of extensions: 232892
Number of successful extensions: 27896
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27870
Number of HSP's gapped (non-prelim): 23
length of query: 1600
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1580
effective length of database: 433,880,813
effective search space: 685531684540
effective search space used: 685531684540
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)