BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.006E19F020311.3.1
(789 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AU252299.1|AU252299 AU252299 salt-stressed barley root c... 70 1e-010
>gb|AU252299.1|AU252299 AU252299 salt-stressed barley root cDNA Hordeum vulgare subsp.
vulgare cDNA clone BR-M09 similar to putative ABC
transporter, mRNA sequence
Length = 423
Score = 69.9 bits (35), Expect = 1e-010
Identities = 113/139 (81%)
Strand = Plus / Plus
Query: 422 ctgtcttctcttctgagtgtcttattcttcacatggatcatcgaacttcttttcccagtt 481
|||||||||||||| ||| ||||||||| |||||| | | ||| || || ||||||
Sbjct: 278 ctgtcttctcttcttggtgcactattcttcagctggatcgttgtactactgtttccagtt 337
Query: 482 atgttgacatatctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcac 541
|| | |||||||| |||||||||||||| || ||||| | ||||||||||| |||||
Sbjct: 338 atactaacatatctcgtgtatgagaagcaacaaaagctgaaaattatgatgaagatgcat 397
Query: 542 ggtctgaaggatgggcctt 560
||| |||||||||| ||||
Sbjct: 398 ggtttgaaggatggccctt 416
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 65,033
Number of Sequences: 312970
Number of extensions: 65033
Number of successful extensions: 15429
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15425
Number of HSP's gapped (non-prelim): 3
length of query: 789
length of database: 175,134,539
effective HSP length: 19
effective length of query: 770
effective length of database: 169,188,109
effective search space: 130274843930
effective search space used: 130274843930
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)