BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131605.2.2
(713 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN817045.1|CN817045 HRO4527_F05_L09ZS5 Lib AA071E1X Aven... 52 7e-007
gb|CN815113.1|CN815113 HRO4506_A05_A10ZS5 Lib AA071E1X Aven... 46 4e-005
>gb|CN817045.1|CN817045 HRO4527_F05_L09ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4527_F05_L09, mRNA sequence
Length = 391
Score = 52.0 bits (26), Expect = 7e-007
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 371 atggtctctgttcattctagccagcagatatacaccagggcaaccaacac 420
|||||||| |||| || ||||||||||| ||||||||||| ||||||||
Sbjct: 9 atggtctcgattcactcgagccagcagatctacaccagggcgaccaacac 58
>gb|CN815113.1|CN815113 HRO4506_A05_A10ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4506_A05_A10, mRNA sequence
Length = 226
Score = 46.1 bits (23), Expect = 4e-005
Identities = 44/51 (86%)
Strand = Plus / Plus
Query: 370 gatggtctctgttcattctagccagcagatatacaccagggcaaccaacac 420
||||||||| ||| ||| ||||||||||| ||||||||||| | ||||||
Sbjct: 7 gatggtctcgattctttcgagccagcagatctacaccagggcgatcaacac 57
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2036
Number of Sequences: 8143
Number of extensions: 2036
Number of successful extensions: 644
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 642
Number of HSP's gapped (non-prelim): 2
length of query: 713
length of database: 4,702,463
effective HSP length: 16
effective length of query: 697
effective length of database: 4,572,175
effective search space: 3186805975
effective search space used: 3186805975
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)