BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521918.2.1
(417 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 52 8e-005
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 52 8e-005
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 52 8e-005
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 52 8e-005
emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 3e-004
gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Rev... 50 3e-004
gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Rev... 50 3e-004
gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Rev... 50 3e-004
gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudo... 50 3e-004
gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudo... 50 3e-004
gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasi... 50 3e-004
gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasi... 50 3e-004
gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone poo... 50 3e-004
gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasi... 50 3e-004
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 50 3e-004
gb|CB074186.1|CB074186 EST02508 Early Ovule Development For... 48 0.001
gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasi... 48 0.001
gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasi... 48 0.001
emb|AX505609.1| Sequence 304 from Patent WO0216655 48 0.001
emb|AX507774.1| Sequence 2469 from Patent WO0216655 48 0.001
gb|CB185793.2|CB185793 EST00720 Arabidopsis avirulent Pseud... 46 0.005
gb|CB185942.1|CB185942 EST01133 Arabidopsis virulent Pseudo... 46 0.005
gb|CB185943.1|CB185943 EST01134 Arabidopsis virulent Pseudo... 46 0.005
gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasi... 46 0.005
gb|U58918.1|ATU58918 Arabidopsis thaliana MEK kinase (MAP3K... 46 0.005
emb|AJ010090.1|ATH010090 Arabidopsis thaliana mRNA for MAP3... 46 0.005
emb|CS137270.1| Sequence 241 from Patent WO2005047516 46 0.005
emb|AJ595464.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.019
emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.019
gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone For... 44 0.019
gb|CF772990.1|CF772990 AG_FSL_10G03 Arabidopsis ag-1 35S:AG... 44 0.019
emb|AJ272202.1|ATH272202 Arabidopsis thaliana mRNA for mito... 44 0.019
emb|AJ293797.1|ATH293797 Arabidopsis thaliana mRNA for SC35... 44 0.019
emb|AJ590285.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseud... 40 0.29
gb|CB185800.1|CB185800 EST00727 Arabidopsis avirulent Pseud... 40 0.29
emb|AJ836339.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
emb|AJ836963.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
emb|AJ837158.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
emb|AJ837256.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
emb|AJ840712.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.29
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
genomic survey sequence
Length = 378
Score = 52.0 bits (26), Expect = 8e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 392 agtacctgcccgggcggccgctcgaa 417
||||||||||||||||||||||||||
Sbjct: 52 agtacctgcccgggcggccgctcgaa 27
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EB10, mRNA sequence
Length = 406
Score = 52.0 bits (26), Expect = 8e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 392 agtacctgcccgggcggccgctcgaa 417
||||||||||||||||||||||||||
Sbjct: 381 agtacctgcccgggcggccgctcgaa 406
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
sequence
Length = 358
Score = 52.0 bits (26), Expect = 8e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 392 agtacctgcccgggcggccgctcgaa 417
||||||||||||||||||||||||||
Sbjct: 328 agtacctgcccgggcggccgctcgaa 353
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH04 similar to PsbA gene in chloroplast
genome, mRNA sequence
Length = 360
Score = 52.0 bits (26), Expect = 8e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 392 agtacctgcccgggcggccgctcgaa 417
||||||||||||||||||||||||||
Sbjct: 331 agtacctgcccgggcggccgctcgaa 356
>emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequence GK-708H07-022965,
genomic survey sequence
Length = 416
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 52 gtacctgcccgggcggccgctcgaa 28
>gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA7 similar to
small nuclear ribosomal protein E, mRNA sequence
Length = 263
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 239 gtacctgcccgggcggccgctcgaa 263
>gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzHA9, mRNA sequence
Length = 328
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 304 gtacctgcccgggcggccgctcgaa 328
>gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Reverse-Subtracted Library
Arabidopsis thaliana cDNA clone AtaOzHC2 similar to
Lhca2 chlorophyll a/b-binding protein, mRNA sequence
Length = 450
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 81 gtacctgcccgggcggccgctcgaa 57
>gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC4-H4 similar
to putative protein with homology to rubisco small
subunit, mRNA sequence
Length = 370
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 84 gtacctgcccgggcggccgctcgaa 60
>gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC1-C2 similar
to putative tyrosine aminotransferase, mRNA sequence
Length = 579
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 59 gtacctgcccgggcggccgctcgaa 35
>gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RAA10 similar to chlorophyll a/b-binding
protein, mRNA sequence
Length = 527
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 366 gtacctgcccgggcggccgctcgaa 390
>gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-FF9 similar to UNKNOWN PROTEIN, mRNA sequence
Length = 421
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 397 gtacctgcccgggcggccgctcgaa 421
>gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH10 similar to putative protein, mRNA
sequence
Length = 305
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 278 gtacctgcccgggcggccgctcgaa 302
>gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EH12 similar to putative protein, mRNA
sequence
Length = 271
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||||
Sbjct: 247 gtacctgcccgggcggccgctcgaa 271
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
Length = 640
Score = 50.1 bits (25), Expect = 3e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 392 agtacctgcccgggcggccgctcga 416
|||||||||||||||||||||||||
Sbjct: 122 agtacctgcccgggcggccgctcga 146
>gb|CB074186.1|CB074186 EST02508 Early Ovule Development Forward Subtracted Library
Arabidopsis thaliana cDNA clone 1D17G5 similar to blue
copper protein, mRNA sequence
Length = 149
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcga 416
||||||||||||||||||||||||
Sbjct: 33 gtacctgcccgggcggccgctcga 10
>gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-BB7 similar to PUTATIVE PROTEIN, mRNA sequence
Length = 320
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
||||||||||||||||||||||||
Sbjct: 213 gtacctgcccgggcggccgctcga 236
>gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-AA5 similar to NAD dependent epimerase, mRNA
sequence
Length = 601
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
||||||||||||||||||||||||
Sbjct: 452 gtacctgcccgggcggccgctcga 475
>emb|AX505609.1| Sequence 304 from Patent WO0216655
Length = 414
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 394 tacctgcccgggcggccgctcgaa 417
||||||||||||||||||||||||
Sbjct: 29 tacctgcccgggcggccgctcgaa 6
>emb|AX507774.1| Sequence 2469 from Patent WO0216655
Length = 238
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcga 416
||||||||||||||||||||||||
Sbjct: 24 gtacctgcccgggcggccgctcga 1
>gb|CB185793.2|CB185793 EST00720 Arabidopsis avirulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone RPM3-G9 similar
to ARF GAP-like zinc finger-containing protein (ZIGA2),
mRNA sequence
Length = 746
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 395 acctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||
Sbjct: 69 acctgcccgggcggccgctcgaa 47
>gb|CB185942.1|CB185942 EST01133 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC8-G7 similar
to putative 60S ribosomal protein L18, mRNA sequence
Length = 602
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 395 acctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||
Sbjct: 68 acctgcccgggcggccgctcgaa 46
>gb|CB185943.1|CB185943 EST01134 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC8-H5 similar
to WD repeat domain containing protein, mRNA sequence
Length = 473
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 395 acctgcccgggcggccgctcgaa 417
|||||||||||||||||||||||
Sbjct: 339 acctgcccgggcggccgctcgaa 361
>gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RBC07 similar to PSI subunit, mRNA sequence
Length = 249
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcg 415
|||||||||||||||||||||||
Sbjct: 224 gtacctgcccgggcggccgctcg 246
>gb|U58918.1|ATU58918 Arabidopsis thaliana MEK kinase (MAP3Ka) mRNA, complete cds
Length = 2267
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 394 tacctgcccgggcggccgctcga 416
|||||||||||||||||||||||
Sbjct: 36 tacctgcccgggcggccgctcga 14
>emb|AJ010090.1|ATH010090 Arabidopsis thaliana mRNA for MAP3K alpha protein kinase
Length = 2189
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 394 tacctgcccgggcggccgctcga 416
|||||||||||||||||||||||
Sbjct: 36 tacctgcccgggcggccgctcga 14
>emb|CS137270.1| Sequence 241 from Patent WO2005047516
Length = 1371
Score = 46.1 bits (23), Expect = 0.005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 394 tacctgcccgggcggccgctcga 416
|||||||||||||||||||||||
Sbjct: 276 tacctgcccgggcggccgctcga 254
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 395 acctgcccgggcggccgctcga 416
||||||||||||||||||||||
Sbjct: 170 acctgcccgggcggccgctcga 149
>emb|AJ595464.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
417C12, genomic survey sequence
Length = 541
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 395 acctgcccgggcggccgctcga 416
||||||||||||||||||||||
Sbjct: 1 acctgcccgggcggccgctcga 22
>emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequence GK-712A09-022963,
genomic survey sequence
Length = 278
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctc 414
||||||||||||||||||||||
Sbjct: 199 gtacctgcccgggcggccgctc 220
>gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone Forward-Subtracted Library
Arabidopsis thaliana cDNA clone AtAOzD61, mRNA sequence
Length = 255
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctc 414
||||||||||||||||||||||
Sbjct: 170 gtacctgcccgggcggccgctc 191
>gb|CF772990.1|CF772990 AG_FSL_10G03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10G03, mRNA sequence
Length = 329
Score = 44.1 bits (22), Expect = 0.019
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcgaa 417
|||||||||||||||| ||||||||
Sbjct: 290 gtacctgcccgggcggncgctcgaa 314
>emb|AJ272202.1|ATH272202 Arabidopsis thaliana mRNA for mitochondrial half-ABC transporter
(STA1 gene)
Length = 2452
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 395 acctgcccgggcggccgctcga 416
||||||||||||||||||||||
Sbjct: 2394 acctgcccgggcggccgctcga 2415
>emb|AJ293797.1|ATH293797 Arabidopsis thaliana mRNA for SC35-like splicing factor SCL28, 28
kD
Length = 1122
Score = 44.1 bits (22), Expect = 0.019
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 395 acctgcccgggcggccgctcga 416
||||||||||||||||||||||
Sbjct: 36 acctgcccgggcggccgctcga 15
>emb|AJ590285.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
566D06, genomic survey sequence
Length = 275
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 110 agcaacaccaacgttgttgatcat 133
||||||||||||| ||||||||||
Sbjct: 183 agcaacaccaacgctgttgatcat 160
>gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone AVR2-A8 similar
to hypothetical protein targeted to chloroplast, mRNA
sequence
Length = 456
Score = 40.1 bits (20), Expect = 0.29
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgc 412
||||||||||||||||||||
Sbjct: 436 gtacctgcccgggcggccgc 455
>gb|CB185800.1|CB185800 EST00727 Arabidopsis avirulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone AVR2-B3 similar
to hypothetical protein, mRNA sequence
Length = 464
Score = 40.1 bits (20), Expect = 0.29
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 393 gtacctgcccgggcggccgctcg 415
||||||||||||| |||||||||
Sbjct: 76 gtacctgcccgggnggccgctcg 54
>emb|AJ836339.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
212B04
Length = 239
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
|||||| |||||||||||||||||
Sbjct: 106 gtacctacccgggcggccgctcga 129
>emb|AJ836963.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
258C06
Length = 244
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
|||||| |||||||||||||||||
Sbjct: 165 gtacctccccgggcggccgctcga 188
>emb|AJ837158.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
270E01
Length = 488
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
|||||| |||||||||||||||||
Sbjct: 421 gtacctccccgggcggccgctcga 444
>emb|AJ837256.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
274B01
Length = 351
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
|||||| |||||||||||||||||
Sbjct: 230 gtacctccccgggcggccgctcga 253
>emb|AJ840712.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
608A06
Length = 786
Score = 40.1 bits (20), Expect = 0.29
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 393 gtacctgcccgggcggccgctcga 416
|||||| |||||||||||||||||
Sbjct: 448 gtacctccccgggcggccgctcga 471
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 187,410
Number of Sequences: 1013581
Number of extensions: 187410
Number of successful extensions: 15388
Number of sequences better than 0.5: 41
Number of HSP's better than 0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15341
Number of HSP's gapped (non-prelim): 47
length of query: 417
length of database: 908,940,872
effective HSP length: 20
effective length of query: 397
effective length of database: 888,669,252
effective search space: 352801693044
effective search space used: 352801693044
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)